Incidental Mutation 'R4096:Homer2'
ID317131
Institutional Source Beutler Lab
Gene Symbol Homer2
Ensembl Gene ENSMUSG00000025813
Gene Namehomer scaffolding protein 2
Synonyms9330120H11Rik, Cupidin, Vesl-2, CPD
MMRRC Submission 041629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4096 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81600481-81707527 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 81611304 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026922] [ENSMUST00000026922] [ENSMUST00000098326] [ENSMUST00000098326] [ENSMUST00000207371] [ENSMUST00000207983] [ENSMUST00000207983] [ENSMUST00000208937]
Predicted Effect probably null
Transcript: ENSMUST00000026922
SMART Domains Protein: ENSMUSP00000026922
Gene: ENSMUSG00000025813

DomainStartEndE-ValueType
WH1 1 107 1.86e-37 SMART
coiled coil region 162 320 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026922
SMART Domains Protein: ENSMUSP00000026922
Gene: ENSMUSG00000025813

DomainStartEndE-ValueType
WH1 1 107 1.86e-37 SMART
coiled coil region 162 320 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098326
SMART Domains Protein: ENSMUSP00000095931
Gene: ENSMUSG00000025813

DomainStartEndE-ValueType
Pfam:WH1 1 43 4.6e-11 PFAM
coiled coil region 98 256 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098326
SMART Domains Protein: ENSMUSP00000095931
Gene: ENSMUSG00000025813

DomainStartEndE-ValueType
Pfam:WH1 1 43 4.6e-11 PFAM
coiled coil region 98 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207526
Predicted Effect probably null
Transcript: ENSMUST00000207983
Predicted Effect probably null
Transcript: ENSMUST00000207983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208858
Predicted Effect probably benign
Transcript: ENSMUST00000208937
Meta Mutation Damage Score 0.9475 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. The encoded protein is a postsynaptic density scaffolding protein. Alternative splicing results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 14. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants exhibit an increase in intracellular calcium concentration and in the frequency of intracellular calcium oscillations in pancreatic acinar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,149 D255G possibly damaging Het
4930407I10Rik G A 15: 82,062,205 G101D probably benign Het
Angpt2 G A 8: 18,698,095 A383V probably damaging Het
Ctns A G 11: 73,186,386 M252T probably benign Het
Dmxl1 T A 18: 49,961,197 H2913Q probably damaging Het
Enox1 C T 14: 77,577,720 T106M probably damaging Het
Ext1 A T 15: 53,073,357 V664E probably damaging Het
Fat4 A T 3: 38,887,875 T306S possibly damaging Het
Fbxl5 T C 5: 43,758,241 I610V probably benign Het
Glb1l T A 1: 75,209,440 M1L probably benign Het
Gm14085 A G 2: 122,522,728 Y463C probably damaging Het
Gm5868 A G 5: 72,586,366 L3P probably damaging Het
Hmcn1 T C 1: 150,658,508 K3005R probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Kcnq3 C A 15: 66,285,815 probably null Het
Mad1l1 C T 5: 140,307,673 R130H probably benign Het
Man2b1 A G 8: 85,084,737 E120G probably damaging Het
Mtus1 T C 8: 41,084,247 D144G probably damaging Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr1023 T C 2: 85,887,423 S208P probably damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Rrp12 A G 19: 41,887,148 I252T probably benign Het
Sbno1 A T 5: 124,391,920 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Srpk2 A T 5: 23,540,502 probably benign Het
Tmem2 G T 19: 21,792,652 M1I probably null Het
Ube3b A G 5: 114,393,086 T214A possibly damaging Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zpld1 C G 16: 55,233,518 D304H probably damaging Het
Other mutations in Homer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Homer2 APN 7 81618572 splice site probably null
IGL02197:Homer2 APN 7 81610399 missense probably benign 0.01
IGL02865:Homer2 APN 7 81610332 missense probably damaging 1.00
IGL02948:Homer2 APN 7 81649645 missense probably damaging 1.00
IGL03035:Homer2 APN 7 81624278 missense possibly damaging 0.57
R0148:Homer2 UTSW 7 81624278 missense probably benign 0.11
R0480:Homer2 UTSW 7 81618603 missense possibly damaging 0.86
R0544:Homer2 UTSW 7 81649678 missense probably damaging 1.00
R1872:Homer2 UTSW 7 81636402 missense probably damaging 0.99
R1873:Homer2 UTSW 7 81636363 missense probably damaging 1.00
R2060:Homer2 UTSW 7 81618703 missense probably benign 0.00
R2148:Homer2 UTSW 7 81624295 missense possibly damaging 0.50
R4888:Homer2 UTSW 7 81649563 missense probably benign 0.02
R5121:Homer2 UTSW 7 81649563 missense probably benign 0.02
R6033:Homer2 UTSW 7 81618679 missense possibly damaging 0.92
R6033:Homer2 UTSW 7 81618679 missense possibly damaging 0.92
R6489:Homer2 UTSW 7 81624278 missense probably benign 0.11
R7652:Homer2 UTSW 7 81649666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGGCTGTGCACAGAAC -3'
(R):5'- AAGTGAGCAAGACAGGTTCC -3'

Sequencing Primer
(F):5'- GCTGTGCACAGAACCTTTG -3'
(R):5'- GTGCATACACAAGTCGGCAATTTTC -3'
Posted On2015-05-15