Incidental Mutation 'R4096:Man2b1'
ID317136
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Namemannosidase 2, alpha B1
Synonymslysosomal alpha-mannosidase
MMRRC Submission 041629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4096 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85083270-85098282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85084737 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 120 (E120G)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000079764] [ENSMUST00000093357] [ENSMUST00000140621] [ENSMUST00000149050] [ENSMUST00000152785] [ENSMUST00000209264] [ENSMUST00000209361]
Predicted Effect probably damaging
Transcript: ENSMUST00000034121
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: E120G

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079764
SMART Domains Protein: ENSMUSP00000078697
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:UPF0139 85 183 6.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093357
SMART Domains Protein: ENSMUSP00000091048
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 98 137 8.1e-9 SMART
WD40 142 179 5.52e-2 SMART
WD40 182 219 1.66e0 SMART
WD40 222 263 7e-4 SMART
WD40 266 304 4.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136696
Predicted Effect probably benign
Transcript: ENSMUST00000140621
SMART Domains Protein: ENSMUSP00000117962
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
Pfam:UPF0139 5 88 1.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148592
Predicted Effect probably benign
Transcript: ENSMUST00000149050
SMART Domains Protein: ENSMUSP00000121568
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152186
Predicted Effect probably benign
Transcript: ENSMUST00000152785
SMART Domains Protein: ENSMUSP00000122127
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 140 177 5.52e-2 SMART
WD40 180 217 1.66e0 SMART
WD40 220 261 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209264
Predicted Effect probably benign
Transcript: ENSMUST00000209361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211379
Meta Mutation Damage Score 0.9606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,149 D255G possibly damaging Het
4930407I10Rik G A 15: 82,062,205 G101D probably benign Het
Angpt2 G A 8: 18,698,095 A383V probably damaging Het
Ctns A G 11: 73,186,386 M252T probably benign Het
Dmxl1 T A 18: 49,961,197 H2913Q probably damaging Het
Enox1 C T 14: 77,577,720 T106M probably damaging Het
Ext1 A T 15: 53,073,357 V664E probably damaging Het
Fat4 A T 3: 38,887,875 T306S possibly damaging Het
Fbxl5 T C 5: 43,758,241 I610V probably benign Het
Glb1l T A 1: 75,209,440 M1L probably benign Het
Gm14085 A G 2: 122,522,728 Y463C probably damaging Het
Gm5868 A G 5: 72,586,366 L3P probably damaging Het
Hmcn1 T C 1: 150,658,508 K3005R probably benign Het
Homer2 A G 7: 81,611,304 probably null Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Kcnq3 C A 15: 66,285,815 probably null Het
Mad1l1 C T 5: 140,307,673 R130H probably benign Het
Mtus1 T C 8: 41,084,247 D144G probably damaging Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr1023 T C 2: 85,887,423 S208P probably damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Rrp12 A G 19: 41,887,148 I252T probably benign Het
Sbno1 A T 5: 124,391,920 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Srpk2 A T 5: 23,540,502 probably benign Het
Tmem2 G T 19: 21,792,652 M1I probably null Het
Ube3b A G 5: 114,393,086 T214A possibly damaging Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zpld1 C G 16: 55,233,518 D304H probably damaging Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85084638 splice site probably null
IGL00671:Man2b1 APN 8 85093938 missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85097430 missense probably benign 0.00
dateline UTSW 8 85084737 missense probably damaging 1.00
meridian UTSW 8 85096752 missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85097489 missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85093016 missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85096776 missense probably benign
R0727:Man2b1 UTSW 8 85091526 missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85096829 missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85095171 missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85086845 missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85093934 missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85086822 missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85095335 missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85085384 missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85093024 splice site probably benign
R3897:Man2b1 UTSW 8 85096948 splice site probably benign
R3971:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R4497:Man2b1 UTSW 8 85090936 missense probably benign 0.22
R5183:Man2b1 UTSW 8 85095784 missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85084459 missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85094210 missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85096752 missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85097046 missense probably benign 0.44
R6341:Man2b1 UTSW 8 85095399 missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85097447 missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85084479 missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85096853 missense probably benign 0.01
R6631:Man2b1 UTSW 8 85086811 unclassified probably null
R6828:Man2b1 UTSW 8 85086919 missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85091071 splice site probably null
R7159:Man2b1 UTSW 8 85087280 missense probably benign 0.09
R7267:Man2b1 UTSW 8 85087175 missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85090965 nonsense probably null
R7786:Man2b1 UTSW 8 85085456 nonsense probably null
R8022:Man2b1 UTSW 8 85095613 missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85097045 missense probably benign 0.03
Z1176:Man2b1 UTSW 8 85093938 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTGAGTTTTCTGGCCTCTG -3'
(R):5'- CTAAGCGGGTAGAACTATGGGTAC -3'

Sequencing Primer
(F):5'- GGCCTCTGTAGCAATGCATATC -3'
(R):5'- AAATCTCAGAGATGCCTGGTTGTCC -3'
Posted On2015-05-15