Incidental Mutation 'R4097:Secisbp2l'
ID317155
Institutional Source Beutler Lab
Gene Symbol Secisbp2l
Ensembl Gene ENSMUSG00000035093
Gene NameSECIS binding protein 2-like
Synonyms3110001I20Rik
MMRRC Submission 040984-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R4097 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125736986-125782870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125740737 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 933 (G933D)
Ref Sequence ENSEMBL: ENSMUSP00000055772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053699
AA Change: G933D

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: G933D

DomainStartEndE-ValueType
low complexity region 441 459 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 700 802 7.6e-24 PFAM
low complexity region 821 831 N/A INTRINSIC
low complexity region 970 978 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139944
SMART Domains Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 326 427 3.5e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,512,364 F292L probably damaging Het
Ankrd36 A G 11: 5,628,703 D664G possibly damaging Het
Bbs1 T A 19: 4,897,317 Y358F probably damaging Het
Becn1 C T 11: 101,294,266 probably benign Het
Cenpp A T 13: 49,493,789 N47I possibly damaging Het
Clec4n A T 6: 123,230,741 H55L possibly damaging Het
Cntnap4 A G 8: 112,752,307 I222V probably benign Het
Cttnbp2 T C 6: 18,420,872 E370G probably benign Het
Cyp4a10 T A 4: 115,529,283 V413E probably damaging Het
Dctn2 C T 10: 127,277,493 L249F probably damaging Het
Dnah9 T C 11: 65,990,459 S146G probably damaging Het
Dzip3 A T 16: 48,958,489 L315* probably null Het
Evpl T C 11: 116,223,177 E1229G possibly damaging Het
Ice2 T C 9: 69,421,671 V775A possibly damaging Het
Jmjd1c A G 10: 67,219,008 E69G probably benign Het
Lrrc66 T A 5: 73,607,704 R665S possibly damaging Het
Mpdz T A 4: 81,335,700 H1065L probably damaging Het
Nrf1 C T 6: 30,151,672 Q503* probably null Het
Nt5dc3 G A 10: 86,833,956 A472T probably benign Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Pramel6 T G 2: 87,509,353 F154V probably benign Het
Ralb T C 1: 119,483,498 D37G probably benign Het
Ranbp9 A T 13: 43,421,257 Y412N probably damaging Het
Scg2 T A 1: 79,435,821 D395V probably damaging Het
Serpine3 T A 14: 62,670,946 L141Q probably damaging Het
Sgpl1 C T 10: 61,103,238 G394D probably damaging Het
Sh3pxd2a T C 19: 47,424,512 Y44C probably damaging Het
Slc6a20b A G 9: 123,612,757 probably benign Het
Snapc5 T C 9: 64,180,527 I40T probably damaging Het
Spopl T C 2: 23,511,401 H365R probably benign Het
Stil T A 4: 115,023,600 I447N probably benign Het
Taf3 C A 2: 9,952,367 V330F possibly damaging Het
Tgoln1 T C 6: 72,615,801 E232G probably damaging Het
Thrap3 A G 4: 126,171,802 L729P probably damaging Het
Tmem269 A T 4: 119,205,780 F220Y probably damaging Het
Tnrc18 ATCTTCC A 5: 142,773,806 probably benign Het
Ubxn6 T C 17: 56,069,712 T227A probably benign Het
Wdr17 C A 8: 54,635,469 R1182I probably damaging Het
Wdr26 T C 1: 181,182,787 I550V probably benign Het
Wdr43 A G 17: 71,657,537 N637S probably benign Het
Zfp516 A G 18: 82,987,256 T762A possibly damaging Het
Other mutations in Secisbp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Secisbp2l APN 2 125743856 missense probably damaging 0.99
IGL00644:Secisbp2l APN 2 125743844 missense probably damaging 1.00
IGL01093:Secisbp2l APN 2 125740325 missense probably benign
IGL01621:Secisbp2l APN 2 125773211 missense probably benign
IGL01955:Secisbp2l APN 2 125743812 critical splice donor site probably null
IGL02036:Secisbp2l APN 2 125758207 missense probably benign
IGL02045:Secisbp2l APN 2 125775578 missense possibly damaging 0.82
IGL02182:Secisbp2l APN 2 125747577 missense probably damaging 1.00
IGL02408:Secisbp2l APN 2 125740869 nonsense probably null
IGL02455:Secisbp2l APN 2 125773478 missense possibly damaging 0.89
IGL02953:Secisbp2l APN 2 125760274 missense probably benign 0.36
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R1415:Secisbp2l UTSW 2 125740365 missense probably benign 0.00
R1626:Secisbp2l UTSW 2 125775686 missense probably damaging 0.99
R1926:Secisbp2l UTSW 2 125740677 missense probably damaging 0.99
R1940:Secisbp2l UTSW 2 125740339 missense probably damaging 1.00
R1970:Secisbp2l UTSW 2 125747510 missense probably damaging 1.00
R2100:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2240:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2252:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2253:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2472:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2474:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2475:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2990:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2993:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3113:Secisbp2l UTSW 2 125750286 missense probably damaging 1.00
R3696:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3750:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3800:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3810:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3812:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3815:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3816:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3817:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3880:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4077:Secisbp2l UTSW 2 125751865 splice site probably benign
R4096:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4164:Secisbp2l UTSW 2 125751883 intron probably benign
R4332:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4418:Secisbp2l UTSW 2 125752915 missense probably benign 0.00
R4598:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4600:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4602:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4603:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4678:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4679:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4684:Secisbp2l UTSW 2 125745942 missense probably damaging 1.00
R4741:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4934:Secisbp2l UTSW 2 125740489 missense probably damaging 0.99
R5245:Secisbp2l UTSW 2 125747591 missense probably damaging 1.00
R5521:Secisbp2l UTSW 2 125752977 missense possibly damaging 0.94
R5547:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5630:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5631:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5632:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6378:Secisbp2l UTSW 2 125768325 missense possibly damaging 0.78
R6616:Secisbp2l UTSW 2 125768226 missense probably damaging 0.96
R6938:Secisbp2l UTSW 2 125750352 missense probably damaging 1.00
R7287:Secisbp2l UTSW 2 125740369 missense probably benign
R7373:Secisbp2l UTSW 2 125757271 missense probably damaging 0.99
R7403:Secisbp2l UTSW 2 125760279 missense possibly damaging 0.73
R7484:Secisbp2l UTSW 2 125771532 nonsense probably null
R7504:Secisbp2l UTSW 2 125758171 missense probably benign 0.30
R7762:Secisbp2l UTSW 2 125768193 missense probably damaging 1.00
R7769:Secisbp2l UTSW 2 125771545 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCTGTGGGCTCATGAC -3'
(R):5'- TGCTTGTAGAGACTAACTGGAGG -3'

Sequencing Primer
(F):5'- GCTGTGGGCTCATGACTATAATCC -3'
(R):5'- GAGCATGGTGGAGACGTCC -3'
Posted On2015-05-15