Mutagenetix > Incidental Mutation

Incidental Mutation 'R4097:Aldh1l2'

317177

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

040984-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83512364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 292 (F292L)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably damaging
Transcript: ENSMUST00000020497
AA Change: F405L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: F405L

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143793

Predicted Effect

probably damaging
Transcript: ENSMUST00000146640
AA Change: F292L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: F292L

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Meta Mutation Damage Score

0.2116

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.1%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd36	A	G	11: 5,628,703	D664G	possibly damaging	Het
Bbs1	T	A	19: 4,897,317	Y358F	probably damaging	Het
Becn1	C	T	11: 101,294,266		probably benign	Het
Cenpp	A	T	13: 49,493,789	N47I	possibly damaging	Het
Clec4n	A	T	6: 123,230,741	H55L	possibly damaging	Het
Cntnap4	A	G	8: 112,752,307	I222V	probably benign	Het
Cttnbp2	T	C	6: 18,420,872	E370G	probably benign	Het
Cyp4a10	T	A	4: 115,529,283	V413E	probably damaging	Het
Dctn2	C	T	10: 127,277,493	L249F	probably damaging	Het
Dnah9	T	C	11: 65,990,459	S146G	probably damaging	Het
Dzip3	A	T	16: 48,958,489	L315*	probably null	Het
Evpl	T	C	11: 116,223,177	E1229G	possibly damaging	Het
Ice2	T	C	9: 69,421,671	V775A	possibly damaging	Het
Jmjd1c	A	G	10: 67,219,008	E69G	probably benign	Het
Lrrc66	T	A	5: 73,607,704	R665S	possibly damaging	Het
Mpdz	T	A	4: 81,335,700	H1065L	probably damaging	Het
Nrf1	C	T	6: 30,151,672	Q503*	probably null	Het
Nt5dc3	G	A	10: 86,833,956	A472T	probably benign	Het
Olfr1012	T	C	2: 85,759,696	I227V	possibly damaging	Het
Olfr829	T	C	9: 18,856,637	I4T	probably benign	Het
Oprk1	T	A	1: 5,602,811		probably benign	Het
Pramel6	T	G	2: 87,509,353	F154V	probably benign	Het
Ralb	T	C	1: 119,483,498	D37G	probably benign	Het
Ranbp9	A	T	13: 43,421,257	Y412N	probably damaging	Het
Scg2	T	A	1: 79,435,821	D395V	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Serpine3	T	A	14: 62,670,946	L141Q	probably damaging	Het
Sgpl1	C	T	10: 61,103,238	G394D	probably damaging	Het
Sh3pxd2a	T	C	19: 47,424,512	Y44C	probably damaging	Het
Slc6a20b	A	G	9: 123,612,757		probably benign	Het
Snapc5	T	C	9: 64,180,527	I40T	probably damaging	Het
Spopl	T	C	2: 23,511,401	H365R	probably benign	Het
Stil	T	A	4: 115,023,600	I447N	probably benign	Het
Taf3	C	A	2: 9,952,367	V330F	possibly damaging	Het
Tgoln1	T	C	6: 72,615,801	E232G	probably damaging	Het
Thrap3	A	G	4: 126,171,802	L729P	probably damaging	Het
Tmem269	A	T	4: 119,205,780	F220Y	probably damaging	Het
Tnrc18	ATCTTCC	A	5: 142,773,806		probably benign	Het
Ubxn6	T	C	17: 56,069,712	T227A	probably benign	Het
Wdr17	C	A	8: 54,635,469	R1182I	probably damaging	Het
Wdr26	T	C	1: 181,182,787	I550V	probably benign	Het
Wdr43	A	G	17: 71,657,537	N637S	probably benign	Het
Zfp516	A	G	18: 82,987,256	T762A	possibly damaging	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACTAAAGCTGGTCTTAAAGGC -3'
(R):5'- GTCCCGAATCTTAACATCTTCTGTAG -3'

Sequencing Primer
(F):5'- AGGCCATATATGTAAATGGCAAATAC -3'
(R):5'- CTGTAGTTGCCACCAAAGATG -3'

Posted On

2015-05-15