Incidental Mutation 'R4097:Dctn2'
ID317179
Institutional Source Beutler Lab
Gene Symbol Dctn2
Ensembl Gene ENSMUSG00000025410
Gene Namedynactin 2
SynonymsRBP50, p50, DCTN-50, C130077D06Rik, 2310042E05Rik
MMRRC Submission 040984-MU
Accession Numbers

Ncbi RefSeq: NM_001190454.1, NM_001190453.1, NM_027151.2; MGI:107733

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4097 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127266368-127281950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127277493 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 249 (L249F)
Ref Sequence ENSEMBL: ENSMUSP00000026479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026476] [ENSMUST00000026479] [ENSMUST00000119078]
Predicted Effect probably benign
Transcript: ENSMUST00000026476
SMART Domains Protein: ENSMUSP00000026476
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 799 N/A INTRINSIC
low complexity region 815 849 N/A INTRINSIC
low complexity region 853 890 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 978 1002 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000026479
AA Change: L249F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410
AA Change: L249F

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119078
SMART Domains Protein: ENSMUSP00000112805
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 798 N/A INTRINSIC
low complexity region 813 847 N/A INTRINSIC
low complexity region 851 888 N/A INTRINSIC
low complexity region 947 956 N/A INTRINSIC
low complexity region 976 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126243
SMART Domains Protein: ENSMUSP00000115238
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 31 76 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 109 146 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
low complexity region 181 211 N/A INTRINSIC
low complexity region 214 282 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 301 322 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
low complexity region 381 446 N/A INTRINSIC
low complexity region 462 496 N/A INTRINSIC
low complexity region 500 537 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136169
SMART Domains Protein: ENSMUSP00000122504
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
low complexity region 84 108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220418
Meta Mutation Damage Score 0.7092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 50-kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 4-5 copies per dynactin molecule. It contains three short alpha-helical coiled-coil domains that may mediate association with self or other dynactin subunits. It may interact directly with the largest subunit (p150) of dynactin and may affix p150 in place. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI

All alleles(28) : Targeted(3) Gene trapped(25)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,512,364 F292L probably damaging Het
Ankrd36 A G 11: 5,628,703 D664G possibly damaging Het
Bbs1 T A 19: 4,897,317 Y358F probably damaging Het
Becn1 C T 11: 101,294,266 probably benign Het
Cenpp A T 13: 49,493,789 N47I possibly damaging Het
Clec4n A T 6: 123,230,741 H55L possibly damaging Het
Cntnap4 A G 8: 112,752,307 I222V probably benign Het
Cttnbp2 T C 6: 18,420,872 E370G probably benign Het
Cyp4a10 T A 4: 115,529,283 V413E probably damaging Het
Dnah9 T C 11: 65,990,459 S146G probably damaging Het
Dzip3 A T 16: 48,958,489 L315* probably null Het
Evpl T C 11: 116,223,177 E1229G possibly damaging Het
Ice2 T C 9: 69,421,671 V775A possibly damaging Het
Jmjd1c A G 10: 67,219,008 E69G probably benign Het
Lrrc66 T A 5: 73,607,704 R665S possibly damaging Het
Mpdz T A 4: 81,335,700 H1065L probably damaging Het
Nrf1 C T 6: 30,151,672 Q503* probably null Het
Nt5dc3 G A 10: 86,833,956 A472T probably benign Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Pramel6 T G 2: 87,509,353 F154V probably benign Het
Ralb T C 1: 119,483,498 D37G probably benign Het
Ranbp9 A T 13: 43,421,257 Y412N probably damaging Het
Scg2 T A 1: 79,435,821 D395V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpine3 T A 14: 62,670,946 L141Q probably damaging Het
Sgpl1 C T 10: 61,103,238 G394D probably damaging Het
Sh3pxd2a T C 19: 47,424,512 Y44C probably damaging Het
Slc6a20b A G 9: 123,612,757 probably benign Het
Snapc5 T C 9: 64,180,527 I40T probably damaging Het
Spopl T C 2: 23,511,401 H365R probably benign Het
Stil T A 4: 115,023,600 I447N probably benign Het
Taf3 C A 2: 9,952,367 V330F possibly damaging Het
Tgoln1 T C 6: 72,615,801 E232G probably damaging Het
Thrap3 A G 4: 126,171,802 L729P probably damaging Het
Tmem269 A T 4: 119,205,780 F220Y probably damaging Het
Tnrc18 ATCTTCC A 5: 142,773,806 probably benign Het
Ubxn6 T C 17: 56,069,712 T227A probably benign Het
Wdr17 C A 8: 54,635,469 R1182I probably damaging Het
Wdr26 T C 1: 181,182,787 I550V probably benign Het
Wdr43 A G 17: 71,657,537 N637S probably benign Het
Zfp516 A G 18: 82,987,256 T762A possibly damaging Het
Other mutations in Dctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dctn2 APN 10 127277690 unclassified probably benign
IGL01749:Dctn2 APN 10 127281417 missense possibly damaging 0.47
IGL01797:Dctn2 APN 10 127277313 missense possibly damaging 0.94
IGL02021:Dctn2 APN 10 127275057 critical splice donor site probably null
IGL02335:Dctn2 APN 10 127275821 splice site probably benign
IGL02748:Dctn2 APN 10 127277273 missense probably damaging 1.00
IGL03382:Dctn2 APN 10 127278188 missense probably damaging 0.99
R0069:Dctn2 UTSW 10 127277485 unclassified probably null
R0069:Dctn2 UTSW 10 127277485 unclassified probably null
R0621:Dctn2 UTSW 10 127277940 critical splice donor site probably null
R1114:Dctn2 UTSW 10 127278142 unclassified probably null
R1917:Dctn2 UTSW 10 127275049 nonsense probably null
R2238:Dctn2 UTSW 10 127276388 missense probably damaging 0.97
R4418:Dctn2 UTSW 10 127278365 missense probably benign 0.24
R4972:Dctn2 UTSW 10 127276703 missense probably damaging 1.00
R6873:Dctn2 UTSW 10 127276236 intron probably null
R7533:Dctn2 UTSW 10 127267478 missense possibly damaging 0.87
R7557:Dctn2 UTSW 10 127278404 missense probably benign 0.44
R7657:Dctn2 UTSW 10 127266514 missense probably damaging 1.00
R8218:Dctn2 UTSW 10 127276529 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGGTGCTCTCCTGTACTAAGTC -3'
(R):5'- CACTTTGGCTTGCAACAGTTC -3'

Sequencing Primer
(F):5'- GTCTACAGTACTCAGAGCCCTG -3'
(R):5'- GGCTTGCAACAGTTCTACCG -3'
Posted On2015-05-15