Incidental Mutation 'R4097:Wdr43'
ID317189
Institutional Source Beutler Lab
Gene Symbol Wdr43
Ensembl Gene ENSMUSG00000041057
Gene NameWD repeat domain 43
Synonyms2610318G08Rik
MMRRC Submission 040984-MU
Accession Numbers

Ncbi RefSeq: NM_175639.1; MGI:1919765

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4097 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71616215-71659031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71657537 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 637 (N637S)
Ref Sequence ENSEMBL: ENSMUSP00000048337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047086]
Predicted Effect probably benign
Transcript: ENSMUST00000047086
AA Change: N637S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048337
Gene: ENSMUSG00000041057
AA Change: N637S

DomainStartEndE-ValueType
WD40 8 42 4.42e1 SMART
WD40 45 110 2.2e2 SMART
WD40 113 154 7.85e-7 SMART
WD40 157 194 1.24e-4 SMART
WD40 197 249 5.52e0 SMART
Blast:WD40 256 299 1e-18 BLAST
low complexity region 320 334 N/A INTRINSIC
Pfam:Utp12 472 575 2.3e-23 PFAM
coiled coil region 635 663 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency 100% (48/48)
Allele List at MGI

All alleles(36) : Gene trapped(36)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,512,364 F292L probably damaging Het
Ankrd36 A G 11: 5,628,703 D664G possibly damaging Het
Bbs1 T A 19: 4,897,317 Y358F probably damaging Het
Becn1 C T 11: 101,294,266 probably benign Het
Cenpp A T 13: 49,493,789 N47I possibly damaging Het
Clec4n A T 6: 123,230,741 H55L possibly damaging Het
Cntnap4 A G 8: 112,752,307 I222V probably benign Het
Cttnbp2 T C 6: 18,420,872 E370G probably benign Het
Cyp4a10 T A 4: 115,529,283 V413E probably damaging Het
Dctn2 C T 10: 127,277,493 L249F probably damaging Het
Dnah9 T C 11: 65,990,459 S146G probably damaging Het
Dzip3 A T 16: 48,958,489 L315* probably null Het
Evpl T C 11: 116,223,177 E1229G possibly damaging Het
Ice2 T C 9: 69,421,671 V775A possibly damaging Het
Jmjd1c A G 10: 67,219,008 E69G probably benign Het
Lrrc66 T A 5: 73,607,704 R665S possibly damaging Het
Mpdz T A 4: 81,335,700 H1065L probably damaging Het
Nrf1 C T 6: 30,151,672 Q503* probably null Het
Nt5dc3 G A 10: 86,833,956 A472T probably benign Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Pramel6 T G 2: 87,509,353 F154V probably benign Het
Ralb T C 1: 119,483,498 D37G probably benign Het
Ranbp9 A T 13: 43,421,257 Y412N probably damaging Het
Scg2 T A 1: 79,435,821 D395V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpine3 T A 14: 62,670,946 L141Q probably damaging Het
Sgpl1 C T 10: 61,103,238 G394D probably damaging Het
Sh3pxd2a T C 19: 47,424,512 Y44C probably damaging Het
Slc6a20b A G 9: 123,612,757 probably benign Het
Snapc5 T C 9: 64,180,527 I40T probably damaging Het
Spopl T C 2: 23,511,401 H365R probably benign Het
Stil T A 4: 115,023,600 I447N probably benign Het
Taf3 C A 2: 9,952,367 V330F possibly damaging Het
Tgoln1 T C 6: 72,615,801 E232G probably damaging Het
Thrap3 A G 4: 126,171,802 L729P probably damaging Het
Tmem269 A T 4: 119,205,780 F220Y probably damaging Het
Tnrc18 ATCTTCC A 5: 142,773,806 probably benign Het
Ubxn6 T C 17: 56,069,712 T227A probably benign Het
Wdr17 C A 8: 54,635,469 R1182I probably damaging Het
Wdr26 T C 1: 181,182,787 I550V probably benign Het
Zfp516 A G 18: 82,987,256 T762A possibly damaging Het
Other mutations in Wdr43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdr43 APN 17 71652814 missense probably damaging 1.00
IGL02077:Wdr43 APN 17 71640291 missense probably benign 0.00
IGL02114:Wdr43 APN 17 71652848 missense probably benign 0.00
IGL02252:Wdr43 APN 17 71626850 missense probably damaging 1.00
IGL02352:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL02359:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL03082:Wdr43 APN 17 71638341 missense probably damaging 0.99
IGL03095:Wdr43 APN 17 71641287 missense probably benign 0.28
IGL02837:Wdr43 UTSW 17 71642736 missense probably benign 0.00
R0039:Wdr43 UTSW 17 71653492 nonsense probably null
R0164:Wdr43 UTSW 17 71631997 splice site probably benign
R0271:Wdr43 UTSW 17 71626825 missense probably benign 0.00
R1117:Wdr43 UTSW 17 71616387 missense probably benign 0.35
R1873:Wdr43 UTSW 17 71633652 missense probably benign 0.05
R1973:Wdr43 UTSW 17 71640240 missense probably benign 0.00
R3620:Wdr43 UTSW 17 71650606 missense probably benign 0.13
R3922:Wdr43 UTSW 17 71638301 splice site probably benign
R5067:Wdr43 UTSW 17 71626854 missense probably benign
R5282:Wdr43 UTSW 17 71648777 missense probably damaging 1.00
R6251:Wdr43 UTSW 17 71650053 splice site probably null
R6364:Wdr43 UTSW 17 71657654 missense probably damaging 0.96
R7086:Wdr43 UTSW 17 71616439 missense probably benign 0.02
R7725:Wdr43 UTSW 17 71616343 missense probably benign 0.27
R8104:Wdr43 UTSW 17 71616355 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTGACGATGAGGTTCCAG -3'
(R):5'- TGGAAGCATATGGTGGCCTC -3'

Sequencing Primer
(F):5'- TCCAGAGAAGGATTCTGATGTG -3'
(R):5'- CTCCCTGGGAGGATGCTATAG -3'
Posted On2015-05-15