Incidental Mutation 'R4109:Slc19a3'
ID 317193
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Name solute carrier family 19, member 3
Synonyms ThTr2, A230084E24Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R4109 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 82990244-83016169 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83000678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 113 (F113Y)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
AlphaFold Q99PL8
Predicted Effect probably damaging
Transcript: ENSMUST00000045560
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142805
Predicted Effect probably damaging
Transcript: ENSMUST00000164473
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Meta Mutation Damage Score 0.4327 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,057,733 (GRCm39) D59E probably benign Het
Acads T C 5: 115,248,913 (GRCm39) *302W probably null Het
Aldh1l1 A G 6: 90,539,626 (GRCm39) E185G probably benign Het
Arhgap20 A G 9: 51,727,985 (GRCm39) H66R possibly damaging Het
Arhgap31 A G 16: 38,422,788 (GRCm39) S1093P probably damaging Het
Atg2a A G 19: 6,308,404 (GRCm39) T1646A possibly damaging Het
Cd200r1 C G 16: 44,610,447 (GRCm39) T185S possibly damaging Het
Cnbd2 T C 2: 156,177,318 (GRCm39) V92A probably damaging Het
Col1a2 A T 6: 4,510,705 (GRCm39) R52* probably null Het
Eml5 T C 12: 98,807,807 (GRCm39) probably null Het
Ifi206 T G 1: 173,308,554 (GRCm39) T481P probably benign Het
Nfya G T 17: 48,699,912 (GRCm39) Y37* probably null Het
Nos1ap A T 1: 170,146,237 (GRCm39) M439K probably benign Het
Paxbp1 T A 16: 90,813,786 (GRCm39) T864S probably benign Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Satb1 A G 17: 52,111,378 (GRCm39) V160A probably damaging Het
Scn3a A G 2: 65,325,379 (GRCm39) I1046T probably benign Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,290,137 (GRCm39) probably benign Het
Slc1a7 T C 4: 107,825,858 (GRCm39) V39A probably benign Het
Spire1 T C 18: 67,630,287 (GRCm39) Q338R probably damaging Het
Supt16 T C 14: 52,400,188 (GRCm39) E985G probably damaging Het
Tmprss11f T C 5: 86,677,795 (GRCm39) K325E possibly damaging Het
Tpo G A 12: 30,142,585 (GRCm39) P713L probably damaging Het
Trav13-2 A C 14: 53,872,698 (GRCm39) H58P probably benign Het
Trbv13-2 A T 6: 41,098,578 (GRCm39) Y51F probably benign Het
Ttn G C 2: 76,581,215 (GRCm39) A23226G probably damaging Het
Ttn C T 2: 76,608,809 (GRCm39) V15990I probably benign Het
Zan G A 5: 137,456,881 (GRCm39) T1285I unknown Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 82,992,557 (GRCm39) missense probably damaging 0.99
tag UTSW 1 83,003,981 (GRCm39) missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83,000,286 (GRCm39) missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83,000,454 (GRCm39) missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83,000,413 (GRCm39) missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83,000,483 (GRCm39) missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83,000,468 (GRCm39) missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 82,997,089 (GRCm39) missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83,000,519 (GRCm39) missense probably benign 0.00
R2058:Slc19a3 UTSW 1 82,992,512 (GRCm39) missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83,000,664 (GRCm39) missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 82,991,691 (GRCm39) missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83,000,756 (GRCm39) missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 82,992,534 (GRCm39) missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83,000,424 (GRCm39) missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83,000,520 (GRCm39) missense probably benign
R4768:Slc19a3 UTSW 1 83,000,834 (GRCm39) missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 82,997,062 (GRCm39) missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83,000,341 (GRCm39) missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83,000,282 (GRCm39) missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83,000,776 (GRCm39) nonsense probably null
R6143:Slc19a3 UTSW 1 83,004,060 (GRCm39) missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83,004,081 (GRCm39) missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83,000,621 (GRCm39) missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83,000,090 (GRCm39) missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 82,991,649 (GRCm39) missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83,003,981 (GRCm39) missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83,000,469 (GRCm39) missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 82,997,162 (GRCm39) missense probably benign 0.02
R8150:Slc19a3 UTSW 1 83,000,216 (GRCm39) missense probably damaging 1.00
R8412:Slc19a3 UTSW 1 82,992,533 (GRCm39) missense probably damaging 0.97
R8970:Slc19a3 UTSW 1 83,000,822 (GRCm39) missense probably damaging 1.00
R9314:Slc19a3 UTSW 1 83,000,094 (GRCm39) missense possibly damaging 0.62
R9671:Slc19a3 UTSW 1 83,000,297 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTATGGCAGGTTCGTCAGG -3'
(R):5'- AAATGTGTTGTGCTTCTGACCATAC -3'

Sequencing Primer
(F):5'- GCAGGTTCGTCAGGGATAC -3'
(R):5'- GACAAATGAGATCCTTCCTGTTTGG -3'
Posted On 2015-05-15