Incidental Mutation 'R0391:Il17rb'
ID 31720
Institutional Source Beutler Lab
Gene Symbol Il17rb
Ensembl Gene ENSMUSG00000015966
Gene Name interleukin 17 receptor B
Synonyms IL17RH1, Evi27, IL-17Rh1, IL-17ER, Il17br
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R0391 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 29996135-30008896 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 30006155 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016110] [ENSMUST00000067620] [ENSMUST00000122205] [ENSMUST00000135888] [ENSMUST00000136726] [ENSMUST00000224797]
AlphaFold Q9JIP3
Predicted Effect probably damaging
Transcript: ENSMUST00000016110
AA Change: P32T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016110
Gene: ENSMUSG00000015966
AA Change: P32T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 175 4.3e-26 PFAM
Pfam:IL17R_fnIII_D2 176 268 1.3e-11 PFAM
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 3.5e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000067620
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122205
AA Change: P32T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113686
Gene: ENSMUSG00000015966
AA Change: P32T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDB:4HSA|F 34 276 2e-23 PDB
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 1.7e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125796
Predicted Effect probably damaging
Transcript: ENSMUST00000135888
AA Change: P32T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121407
Gene: ENSMUSG00000015966
AA Change: P32T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 123 1.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136726
AA Change: P32T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117802
Gene: ENSMUSG00000015966
AA Change: P32T

DomainStartEndE-ValueType
PDB:3JVF|C 13 171 5e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000224797
Meta Mutation Damage Score 0.0916 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are homozygous for a null allele have defects in their response to IL17A or IL17F. In addition this locus is a common site of retoviral integration in BXH2 murine myeloid leukemias and occurred at a CpG island 6 kb upstream of the Il17rb gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Il17rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Il17rb APN 14 30003680 missense probably damaging 1.00
IGL03151:Il17rb APN 14 30006853 missense probably benign 0.05
R0276:Il17rb UTSW 14 30004380 missense probably damaging 1.00
R0391:Il17rb UTSW 14 30004347 missense probably benign 0.00
R0408:Il17rb UTSW 14 29996680 missense probably benign 0.02
R2011:Il17rb UTSW 14 29996840 nonsense probably null
R2012:Il17rb UTSW 14 29996840 nonsense probably null
R2057:Il17rb UTSW 14 29997154 missense probably benign 0.01
R2227:Il17rb UTSW 14 30006081 missense probably benign 0.02
R3548:Il17rb UTSW 14 30008772 splice site probably null
R4199:Il17rb UTSW 14 29996644 missense probably benign
R4578:Il17rb UTSW 14 30002399 missense probably damaging 0.97
R5092:Il17rb UTSW 14 30002376 missense probably benign 0.00
R5928:Il17rb UTSW 14 30004275 critical splice donor site probably null
R6280:Il17rb UTSW 14 30002971 missense probably benign 0.00
R6378:Il17rb UTSW 14 30000363 missense probably damaging 0.97
R6470:Il17rb UTSW 14 30002909 missense probably benign 0.10
R6741:Il17rb UTSW 14 30000336 missense possibly damaging 0.82
R6919:Il17rb UTSW 14 30004271 splice site probably null
R7133:Il17rb UTSW 14 29996871 missense probably damaging 1.00
R7423:Il17rb UTSW 14 29997115 missense probably damaging 0.97
R7470:Il17rb UTSW 14 29998033 missense probably damaging 1.00
R7559:Il17rb UTSW 14 29997043 missense probably damaging 1.00
R7847:Il17rb UTSW 14 29996806 missense probably damaging 1.00
R8685:Il17rb UTSW 14 30004340 missense probably benign 0.32
R8835:Il17rb UTSW 14 30000351 missense possibly damaging 0.95
R9025:Il17rb UTSW 14 30002900 intron probably benign
R9434:Il17rb UTSW 14 30006097 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGATGCAAACTTACCGTCTGCC -3'
(R):5'- ACATGGGAAGCAGTACCTGTCACC -3'

Sequencing Primer
(F):5'- CCCGGAGTATCCAGCTTATG -3'
(R):5'- acacacacacacaaacacac -3'
Posted On 2013-04-24