Incidental Mutation 'R4109:Cnbd2'
ID317201
Institutional Source Beutler Lab
Gene Symbol Cnbd2
Ensembl Gene ENSMUSG00000038085
Gene Namecyclic nucleotide binding domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4109 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156312299-156375638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156335398 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000105208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037096] [ENSMUST00000073942] [ENSMUST00000109580]
Predicted Effect probably damaging
Transcript: ENSMUST00000037096
AA Change: V221A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041268
Gene: ENSMUSG00000038085
AA Change: V221A

DomainStartEndE-ValueType
low complexity region 45 68 N/A INTRINSIC
cNMP 206 332 1.78e-7 SMART
Blast:cNMP 376 443 4e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000073942
AA Change: V104A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073598
Gene: ENSMUSG00000038085
AA Change: V104A

DomainStartEndE-ValueType
cNMP 89 215 1.78e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109580
AA Change: V92A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105208
Gene: ENSMUSG00000038085
AA Change: V92A

DomainStartEndE-ValueType
cNMP 77 203 1.78e-7 SMART
Blast:cNMP 247 314 3e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility associated with impaired spermiogenesis and development of flagellum bending. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,295,103 D59E probably benign Het
Acads T C 5: 115,110,854 *302W probably null Het
Aldh1l1 A G 6: 90,562,644 E185G probably benign Het
Arhgap20 A G 9: 51,816,685 H66R possibly damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atg2a A G 19: 6,258,374 T1646A possibly damaging Het
Cd200r1 C G 16: 44,790,084 T185S possibly damaging Het
Col1a2 A T 6: 4,510,705 R52* probably null Het
Eml5 T C 12: 98,841,548 probably null Het
Ifi206 T G 1: 173,480,988 T481P probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Nos1ap A T 1: 170,318,668 M439K probably benign Het
Paxbp1 T A 16: 91,016,898 T864S probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Satb1 A G 17: 51,804,350 V160A probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc1a7 T C 4: 107,968,661 V39A probably benign Het
Spire1 T C 18: 67,497,217 Q338R probably damaging Het
Supt16 T C 14: 52,162,731 E985G probably damaging Het
Tmprss11f T C 5: 86,529,936 K325E possibly damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trav13-2 A C 14: 53,635,241 H58P probably benign Het
Trbv13-2 A T 6: 41,121,644 Y51F probably benign Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Zan G A 5: 137,458,619 T1285I unknown Het
Other mutations in Cnbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Cnbd2 APN 2 156312614 unclassified probably benign
IGL01472:Cnbd2 APN 2 156375348 missense probably damaging 1.00
IGL01738:Cnbd2 APN 2 156375617 utr 3 prime probably benign
IGL01825:Cnbd2 APN 2 156338709 missense probably damaging 1.00
IGL03001:Cnbd2 APN 2 156333634 critical splice donor site probably null
IGL03057:Cnbd2 APN 2 156367672 missense possibly damaging 0.80
R1006:Cnbd2 UTSW 2 156328408 missense possibly damaging 0.86
R1080:Cnbd2 UTSW 2 156339273 missense probably benign 0.28
R1428:Cnbd2 UTSW 2 156339284 critical splice donor site probably null
R1592:Cnbd2 UTSW 2 156335402 missense probably benign 0.30
R1601:Cnbd2 UTSW 2 156333631 missense probably damaging 0.98
R1637:Cnbd2 UTSW 2 156373724 missense probably damaging 1.00
R2259:Cnbd2 UTSW 2 156335272 missense probably damaging 1.00
R2352:Cnbd2 UTSW 2 156335355 missense probably damaging 1.00
R4106:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4479:Cnbd2 UTSW 2 156333653 intron probably benign
R4857:Cnbd2 UTSW 2 156367565 missense probably benign 0.01
R4893:Cnbd2 UTSW 2 156365184 missense probably damaging 0.97
R4899:Cnbd2 UTSW 2 156339221 missense probably benign 0.00
R5070:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R5446:Cnbd2 UTSW 2 156367661 missense possibly damaging 0.95
R5784:Cnbd2 UTSW 2 156338657 missense probably damaging 1.00
R6197:Cnbd2 UTSW 2 156375574 missense possibly damaging 0.86
R7009:Cnbd2 UTSW 2 156320034 missense probably benign 0.00
R7221:Cnbd2 UTSW 2 156373661 missense probably benign 0.01
R7577:Cnbd2 UTSW 2 156328376 missense possibly damaging 0.93
X0002:Cnbd2 UTSW 2 156338697 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTTCCCGTGAGTAGAATGGGTG -3'
(R):5'- CATCTCGGATTCCAGGACTGTC -3'

Sequencing Primer
(F):5'- CAATATGGAGAGTCGCCTGCTG -3'
(R):5'- TCATCTGAGGAGGACTCTCAG -3'
Posted On2015-05-15