Incidental Mutation 'R4109:Trbv13-2'
ID317208
Institutional Source Beutler Lab
Gene Symbol Trbv13-2
Ensembl Gene ENSMUSG00000076469
Gene NameT cell receptor beta, variable 13-2
SynonymsTcrb-V8.2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.038) question?
Stock #R4109 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41121396-41121832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41121644 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 51 (Y51F)
Ref Sequence ENSEMBL: ENSMUSP00000100086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103269] [ENSMUST00000103270]
Predicted Effect probably benign
Transcript: ENSMUST00000103269
SMART Domains Protein: ENSMUSP00000100085
Gene: ENSMUSG00000094525

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:V-set 30 124 4.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103270
AA Change: Y51F

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100086
Gene: ENSMUSG00000076469
AA Change: Y51F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGv 36 111 8.2e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal T cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,295,103 D59E probably benign Het
Acads T C 5: 115,110,854 *302W probably null Het
Aldh1l1 A G 6: 90,562,644 E185G probably benign Het
Arhgap20 A G 9: 51,816,685 H66R possibly damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atg2a A G 19: 6,258,374 T1646A possibly damaging Het
Cd200r1 C G 16: 44,790,084 T185S possibly damaging Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Col1a2 A T 6: 4,510,705 R52* probably null Het
Eml5 T C 12: 98,841,548 probably null Het
Ifi206 T G 1: 173,480,988 T481P probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Nos1ap A T 1: 170,318,668 M439K probably benign Het
Paxbp1 T A 16: 91,016,898 T864S probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Satb1 A G 17: 51,804,350 V160A probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc1a7 T C 4: 107,968,661 V39A probably benign Het
Spire1 T C 18: 67,497,217 Q338R probably damaging Het
Supt16 T C 14: 52,162,731 E985G probably damaging Het
Tmprss11f T C 5: 86,529,936 K325E possibly damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trav13-2 A C 14: 53,635,241 H58P probably benign Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Zan G A 5: 137,458,619 T1285I unknown Het
Other mutations in Trbv13-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02799:Trbv13-2 UTSW 6 41121537 critical splice acceptor site probably benign
PIT4354001:Trbv13-2 UTSW 6 41121818 missense probably damaging 1.00
R2961:Trbv13-2 UTSW 6 41121640 missense probably damaging 0.98
R5104:Trbv13-2 UTSW 6 41121811 missense probably damaging 1.00
R5656:Trbv13-2 UTSW 6 41121694 missense probably benign 0.02
R7754:Trbv13-2 UTSW 6 41121700 missense probably benign 0.02
R7839:Trbv13-2 UTSW 6 41121587 missense probably benign 0.00
R7922:Trbv13-2 UTSW 6 41121587 missense probably benign 0.00
R8048:Trbv13-2 UTSW 6 41121559 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCAGTCTCCTGTGTTCAAGTG -3'
(R):5'- TGGCACAGAAGTACACTGATG -3'

Sequencing Primer
(F):5'- AGGCCACAGGTGTGCTTCTC -3'
(R):5'- CACAGAAGTACACTGATGTCTGAG -3'
Posted On2015-05-15