Mutagenetix > Incidental Mutation

Incidental Mutation 'R0391:Stab1'

31721

Institutional Source

Beutler Lab

Gene Symbol

Stab1

Ensembl Gene

ENSMUSG00000042286

Gene Name

stabilin 1

Synonyms

MS-1

MMRRC Submission

038597-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0391 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31139013-31168641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31143418 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1814 (L1814P)

Ref Sequence

ENSEMBL: ENSMUSP00000046199 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000090212] [ENSMUST00000159249] [ENSMUST00000160024] [ENSMUST00000227096] [ENSMUST00000227794]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000036618
AA Change: L1814P

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: L1814P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	112	149	6.65e-2	SMART
EGF	160	194	2.28e0	SMART
EGF	199	232	1.4e0	SMART
EGF	236	272	4.97e-1	SMART
EGF	276	319	1.95e1	SMART
EGF_like	321	357	5.03e1	SMART
low complexity region	400	413	N/A	INTRINSIC
Blast:FAS1	414	501	2e-52	BLAST
FAS1	543	645	1.35e-24	SMART
EGF_like	780	817	5.45e1	SMART
EGF	822	861	1.08e-1	SMART
EGF	865	904	3.15e-3	SMART
EGF	908	947	1.3e1	SMART
EGF	951	989	1.47e1	SMART
FAS1	1023	1122	1.3e-17	SMART
FAS1	1165	1257	2.94e0	SMART
EGF	1332	1369	1.4e0	SMART
EGF	1379	1413	1.88e-1	SMART
EGF	1420	1455	6.02e0	SMART
EGF	1459	1497	3.82e-2	SMART
EGF	1501	1540	2.05e-2	SMART
EGF	1544	1583	2.25e1	SMART
FAS1	1616	1712	1.61e-22	SMART
FAS1	1763	1868	2.12e-17	SMART
EGF	1970	2007	1.26e-2	SMART
EGF	2017	2051	1.61e0	SMART
EGF	2059	2090	2.45e0	SMART
EGF	2094	2131	3.46e0	SMART
EGF	2135	2174	3.82e-2	SMART
LINK	2206	2301	8.55e-49	SMART
FAS1	2367	2462	2.06e-6	SMART
transmembrane domain	2476	2498	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090212

SMART Domains

Protein: ENSMUSP00000087680
Gene: ENSMUSG00000071547

Domain	Start	End	E-Value	Type
Pfam:5_nucleotid	1	367	1.5e-123	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159208

Predicted Effect

probably benign
Transcript: ENSMUST00000159249

SMART Domains

Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286

Domain	Start	End	E-Value	Type
EGF	110	147	1.26e-2	SMART
EGF	157	191	1.61e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159480

Predicted Effect

probably benign
Transcript: ENSMUST00000160024

SMART Domains

Protein: ENSMUSP00000125239
Gene: ENSMUSG00000042286

Domain	Start	End	E-Value	Type
Blast:FAS1	1	32	5e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160720

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162169

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162763

Predicted Effect

probably benign
Transcript: ENSMUST00000227096

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227690

Predicted Effect

probably benign
Transcript: ENSMUST00000227794

Predicted Effect

probably benign
Transcript: ENSMUST00000226975

Meta Mutation Damage Score

0.1076

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.8%

Validation Efficiency

97% (97/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	T	A	4: 122,701,177		probably benign	Het
Abcc2	G	A	19: 43,821,605		probably benign	Het
Abcc8	C	G	7: 46,122,173	G838A	probably damaging	Het
Akr1c21	G	A	13: 4,581,200	A245T	probably damaging	Het
Anapc15-ps	T	C	10: 95,673,277	E47G	probably damaging	Het
Apoa1	A	G	9: 46,229,842	T79A	probably benign	Het
Atp6v1b1	A	G	6: 83,756,921	H378R	possibly damaging	Het
C4b	A	G	17: 34,735,614		probably benign	Het
Catsperd	A	T	17: 56,662,821	E638D	probably benign	Het
Cckar	C	T	5: 53,706,253		probably null	Het
Cfap100	C	T	6: 90,405,339		probably benign	Het
Chd1	G	T	17: 15,749,894	G970C	probably damaging	Het
Col14a1	A	G	15: 55,446,259		probably benign	Het
Col17a1	C	T	19: 47,663,824	V698M	probably damaging	Het
Cpeb1	T	C	7: 81,361,725	D156G	possibly damaging	Het
Cryl1	A	G	14: 57,303,775	Y151H	possibly damaging	Het
Csmd3	C	A	15: 47,657,573	V1881L	probably damaging	Het
Ctnnal1	C	T	4: 56,847,921	A73T	probably damaging	Het
Cyp2c37	T	C	19: 39,994,506	S180P	probably damaging	Het
Cyp2c54	T	C	19: 40,072,169	T123A	possibly damaging	Het
Dennd6b	T	C	15: 89,187,214	D304G	probably damaging	Het
Dnmt3l	T	C	10: 78,051,916		probably benign	Het
Eci1	G	A	17: 24,433,260		probably null	Het
Efhc1	A	G	1: 20,960,188	Y115C	probably damaging	Het
Ern1	T	A	11: 106,407,178	K706*	probably null	Het
Fam129c	T	A	8: 71,602,499		probably benign	Het
Ghrl	T	C	6: 113,719,338	E31G	probably damaging	Het
Gpr108	A	C	17: 57,243,101	V179G	probably benign	Het
Henmt1	A	G	3: 108,958,535		probably benign	Het
Ift172	A	G	5: 31,286,667	V69A	probably damaging	Het
Il17ra	T	C	6: 120,476,979		probably benign	Het
Il17rb	T	C	14: 30,004,347	N95D	probably benign	Het
Il17rb	G	T	14: 30,006,155		probably null	Het
Iqub	G	A	6: 24,446,155	L757F	probably benign	Het
Itpr1	T	C	6: 108,378,167	V473A	probably benign	Het
Itpr2	T	G	6: 146,229,773	N1978H	probably damaging	Het
Klk1b26	T	A	7: 44,012,727	F3Y	probably damaging	Het
Lars	A	G	18: 42,251,363	V50A	probably benign	Het
Lax1	G	T	1: 133,680,066	H312Q	probably benign	Het
Lctl	T	C	9: 64,122,314		probably benign	Het
Lrp2	T	A	2: 69,456,858	D3745V	probably damaging	Het
Lrp2	G	A	2: 69,460,337		probably benign	Het
Lvrn	A	T	18: 46,850,466	H92L	probably benign	Het
March1	A	G	8: 66,418,973	T385A	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mbd5	T	C	2: 49,272,416	V970A	possibly damaging	Het
Mccc1	A	G	3: 35,963,570		probably benign	Het
Mpp4	A	T	1: 59,143,829		probably benign	Het
Mrnip	G	A	11: 50,199,920	A304T	probably damaging	Het
Muc5b	T	C	7: 141,865,082	S3922P	possibly damaging	Het
Myh3	T	A	11: 67,096,507		probably benign	Het
Nbea	A	T	3: 56,037,277	H555Q	probably damaging	Het
Nlrp9c	A	T	7: 26,371,476		probably benign	Het
Nmur1	A	T	1: 86,387,678	V178E	probably damaging	Het
Nod2	T	G	8: 88,663,778	S238A	probably benign	Het
Ogfod1	A	T	8: 94,063,023	T451S	probably damaging	Het
Olfr145	G	A	9: 37,897,842	G146D	probably benign	Het
Olfr23	T	C	11: 73,941,109	F288L	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr716	T	A	7: 107,148,187	Y290*	probably null	Het
Pcdh20	T	C	14: 88,468,668	I399V	probably benign	Het
Pdlim1	G	T	19: 40,243,573	H120Q	probably damaging	Het
Plg	T	C	17: 12,419,081	V798A	probably damaging	Het
Polr2c	A	G	8: 94,857,775	I39V	possibly damaging	Het
Ppfia2	C	A	10: 106,830,714		probably benign	Het
Ppp1r3a	A	T	6: 14,719,697	I406N	probably benign	Het
Psg28	A	T	7: 18,426,173	M366K	probably benign	Het
Rad54b	T	C	4: 11,601,702	I419T	probably damaging	Het
Rnf43	A	G	11: 87,731,282	Q403R	possibly damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc28a3	A	G	13: 58,569,415		probably benign	Het
Smad2	A	T	18: 76,289,037		probably null	Het
Smad4	G	A	18: 73,658,649	P274S	probably benign	Het
Smchd1	A	T	17: 71,403,154	V906D	probably damaging	Het
Soat2	C	A	15: 102,158,753	R320S	possibly damaging	Het
Spata33	C	T	8: 123,221,887	A57V	probably damaging	Het
Stab2	T	C	10: 86,947,144	K680R	probably benign	Het
Stil	A	G	4: 115,041,172		probably null	Het
Sympk	T	A	7: 19,046,849	L759H	probably benign	Het
Tet1	A	T	10: 62,814,546		probably null	Het
Tfpi2	A	T	6: 3,965,460	N117K	probably benign	Het
Tle3	A	G	9: 61,416,661	Y766C	probably damaging	Het
Trpt1	C	A	19: 6,997,930		probably null	Het
Tshz1	A	G	18: 84,016,049	F78S	possibly damaging	Het
Ttc1	T	C	11: 43,738,808	D177G	probably damaging	Het
Ttc13	T	A	8: 124,674,401	Y741F	probably damaging	Het
Ulk3	C	T	9: 57,594,832	S462L	probably benign	Het
Utrn	C	T	10: 12,525,333		probably benign	Het
V1rd19	A	C	7: 24,003,585	T159P	probably damaging	Het
Vars	T	C	17: 35,011,486	V515A	possibly damaging	Het
Vmn1r85	A	G	7: 13,084,588	Y210H	probably benign	Het
Vmn2r89	A	G	14: 51,455,978	T262A	probably damaging	Het
Vps53	G	A	11: 76,121,579	T209I	probably benign	Het
Wdfy2	T	C	14: 62,925,133	F95L	possibly damaging	Het
Wwp1	G	T	4: 19,627,911	S694Y	probably damaging	Het
Zbtb8b	T	A	4: 129,432,670	D201V	probably damaging	Het
Zmym5	A	C	14: 56,804,451	N123K	possibly damaging	Het

Other mutations in Stab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Stab1	APN	14	31161357	missense	probably benign	0.01
IGL00323:Stab1	APN	14	31139306	missense	probably benign	0.04
IGL00515:Stab1	APN	14	31159729	missense	probably benign	0.20
IGL00844:Stab1	APN	14	31147066	missense	probably damaging	1.00
IGL01374:Stab1	APN	14	31147075	missense	probably damaging	1.00
IGL01384:Stab1	APN	14	31150408	missense	probably benign
IGL01431:Stab1	APN	14	31148995	missense	probably benign	0.06
IGL01787:Stab1	APN	14	31139808	missense	probably damaging	1.00
IGL02128:Stab1	APN	14	31150441	missense	probably damaging	1.00
IGL02138:Stab1	APN	14	31143513	critical splice donor site	probably null
IGL02256:Stab1	APN	14	31141592	missense	probably damaging	1.00
IGL02340:Stab1	APN	14	31140410	missense	probably damaging	0.96
IGL02507:Stab1	APN	14	31139210	unclassified	probably benign
IGL02695:Stab1	APN	14	31159271	missense	probably damaging	1.00
IGL02755:Stab1	APN	14	31139638	missense	probably benign	0.01
IGL02870:Stab1	APN	14	31139397	missense	probably benign	0.00
IGL02884:Stab1	APN	14	31150143	splice site	probably null
IGL03035:Stab1	APN	14	31147769	missense	probably benign	0.00
IGL03267:Stab1	APN	14	31142729	missense	probably damaging	1.00
IGL03286:Stab1	APN	14	31159326	splice site	probably benign
IGL03366:Stab1	APN	14	31150263	missense	possibly damaging	0.58
IGL03412:Stab1	APN	14	31154407	missense	probably benign	0.42
R0906_Stab1_335	UTSW	14	31145249	missense	probably benign	0.19
R5086_Stab1_467	UTSW	14	31159304	missense	probably damaging	1.00
IGL02835:Stab1	UTSW	14	31146024	critical splice donor site	probably null
K7371:Stab1	UTSW	14	31150249	missense	probably damaging	1.00
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0363:Stab1	UTSW	14	31159008	splice site	probably benign
R0387:Stab1	UTSW	14	31148101	missense	probably benign	0.00
R0513:Stab1	UTSW	14	31148945	missense	probably benign	0.08
R0546:Stab1	UTSW	14	31139550	missense	possibly damaging	0.92
R0825:Stab1	UTSW	14	31152600	missense	probably benign	0.16
R0906:Stab1	UTSW	14	31145249	missense	probably benign	0.19
R0963:Stab1	UTSW	14	31147274	missense	probably damaging	0.97
R1219:Stab1	UTSW	14	31140621	splice site	probably null
R1234:Stab1	UTSW	14	31150236	missense	probably damaging	1.00
R1260:Stab1	UTSW	14	31151889	missense	probably damaging	1.00
R1400:Stab1	UTSW	14	31139830	missense	possibly damaging	0.92
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1440:Stab1	UTSW	14	31151690	nonsense	probably null
R1472:Stab1	UTSW	14	31141586	missense	probably benign	0.01
R1474:Stab1	UTSW	14	31149861	missense	probably benign	0.45
R1475:Stab1	UTSW	14	31163828	missense	probably benign
R1509:Stab1	UTSW	14	31151584	splice site	probably benign
R1551:Stab1	UTSW	14	31160499	missense	probably benign	0.00
R1572:Stab1	UTSW	14	31150823	missense	probably damaging	1.00
R1633:Stab1	UTSW	14	31150380	splice site	probably null
R1719:Stab1	UTSW	14	31146028	nonsense	probably null
R1733:Stab1	UTSW	14	31145303	missense	probably damaging	1.00
R1763:Stab1	UTSW	14	31168416	missense	probably benign	0.04
R1808:Stab1	UTSW	14	31141144	missense	possibly damaging	0.80
R1816:Stab1	UTSW	14	31157465	missense	probably benign	0.03
R1853:Stab1	UTSW	14	31140463	missense	probably damaging	1.00
R1891:Stab1	UTSW	14	31141330	missense	probably benign	0.07
R1984:Stab1	UTSW	14	31150648	missense	probably benign	0.20
R1998:Stab1	UTSW	14	31162153	nonsense	probably null
R2165:Stab1	UTSW	14	31168435	missense	probably benign	0.20
R2191:Stab1	UTSW	14	31142800	missense	probably benign	0.03
R2191:Stab1	UTSW	14	31159270	missense	probably damaging	1.00
R2233:Stab1	UTSW	14	31161880	missense	probably benign	0.08
R2303:Stab1	UTSW	14	31146070	missense	probably damaging	1.00
R2496:Stab1	UTSW	14	31161463	missense	probably damaging	1.00
R2504:Stab1	UTSW	14	31163040	critical splice donor site	probably null
R2519:Stab1	UTSW	14	31154872	missense	probably damaging	1.00
R2926:Stab1	UTSW	14	31161799	missense	probably damaging	1.00
R4025:Stab1	UTSW	14	31154952	missense	possibly damaging	0.46
R4113:Stab1	UTSW	14	31168479	missense	probably damaging	0.98
R4258:Stab1	UTSW	14	31154672	missense	possibly damaging	0.92
R4588:Stab1	UTSW	14	31157445	missense	probably benign	0.01
R4644:Stab1	UTSW	14	31140487	unclassified	probably benign
R4660:Stab1	UTSW	14	31154915	missense	possibly damaging	0.91
R4801:Stab1	UTSW	14	31141371	nonsense	probably null
R4802:Stab1	UTSW	14	31141371	nonsense	probably null
R4870:Stab1	UTSW	14	31142043	missense	probably benign	0.13
R4872:Stab1	UTSW	14	31140393	missense	probably damaging	1.00
R4881:Stab1	UTSW	14	31143672	missense	probably benign	0.32
R4941:Stab1	UTSW	14	31151571	missense	probably benign	0.00
R5061:Stab1	UTSW	14	31163099	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31143624	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5087:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5092:Stab1	UTSW	14	31145855	missense	probably benign	0.01
R5102:Stab1	UTSW	14	31148017	critical splice donor site	probably null
R5107:Stab1	UTSW	14	31163795	splice site	probably null
R5195:Stab1	UTSW	14	31140521	unclassified	probably benign
R5217:Stab1	UTSW	14	31159519	missense	probably benign	0.25
R5285:Stab1	UTSW	14	31143476	unclassified	probably benign
R5327:Stab1	UTSW	14	31161836	nonsense	probably null
R5647:Stab1	UTSW	14	31157440	nonsense	probably null
R5696:Stab1	UTSW	14	31160221	missense	probably benign
R5996:Stab1	UTSW	14	31139551	missense	probably benign	0.39
R6016:Stab1	UTSW	14	31158993	missense	probably damaging	1.00
R6017:Stab1	UTSW	14	31141544	missense	probably benign	0.00
R6174:Stab1	UTSW	14	31162519	nonsense	probably null
R6366:Stab1	UTSW	14	31141438	missense	probably benign	0.10
R6754:Stab1	UTSW	14	31141081	missense	probably benign
R6788:Stab1	UTSW	14	31139160	missense	probably damaging	1.00
R6898:Stab1	UTSW	14	31158963	missense	probably benign	0.00
R7124:Stab1	UTSW	14	31160867	missense	possibly damaging	0.94
R7145:Stab1	UTSW	14	31145073	critical splice donor site	probably null
R7153:Stab1	UTSW	14	31160584	missense	probably benign	0.16
R7213:Stab1	UTSW	14	31143673	missense	probably benign
R7215:Stab1	UTSW	14	31160797	missense	possibly damaging	0.93
R7319:Stab1	UTSW	14	31140826	missense	probably damaging	1.00
R7389:Stab1	UTSW	14	31147239	missense	probably benign	0.00
R7400:Stab1	UTSW	14	31157384	missense	probably null	1.00
R7427:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7428:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7484:Stab1	UTSW	14	31160317	missense	probably benign	0.00
R7568:Stab1	UTSW	14	31152595	missense	probably damaging	1.00
R7574:Stab1	UTSW	14	31154665	missense	probably benign
R7619:Stab1	UTSW	14	31145237	missense	probably benign
R7623:Stab1	UTSW	14	31140621	missense	probably benign	0.03
R7721:Stab1	UTSW	14	31141456	missense	possibly damaging	0.48
R7869:Stab1	UTSW	14	31154472	missense	probably benign	0.01
R7936:Stab1	UTSW	14	31157415	missense	possibly damaging	0.88
R7956:Stab1	UTSW	14	31160024	missense	probably benign	0.02
R7973:Stab1	UTSW	14	31159633	critical splice donor site	probably null
R8059:Stab1	UTSW	14	31160241	missense	probably benign	0.02
R8116:Stab1	UTSW	14	31158953	missense	possibly damaging	0.80
R8304:Stab1	UTSW	14	31148954	missense	probably benign	0.14
R8368:Stab1	UTSW	14	31148411	missense	possibly damaging	0.91
R8495:Stab1	UTSW	14	31155833	missense	probably damaging	1.00
R8513:Stab1	UTSW	14	31149790	critical splice donor site	probably null
R8544:Stab1	UTSW	14	31163051	nonsense	probably null
R8671:Stab1	UTSW	14	31157408	missense	probably damaging	1.00
R8885:Stab1	UTSW	14	31161814	missense	possibly damaging	0.79
R8974:Stab1	UTSW	14	31160822	missense	probably benign
R9022:Stab1	UTSW	14	31160269	missense	probably benign	0.01
R9059:Stab1	UTSW	14	31154848	missense	probably benign	0.01
R9226:Stab1	UTSW	14	31145855	missense	probably benign	0.00
R9272:Stab1	UTSW	14	31145341	missense	probably benign	0.05
R9388:Stab1	UTSW	14	31154355	missense	probably damaging	1.00
R9401:Stab1	UTSW	14	31161112	missense	probably benign
R9433:Stab1	UTSW	14	31143574	missense	probably benign	0.00
R9450:Stab1	UTSW	14	31162939	missense	possibly damaging	0.62
R9505:Stab1	UTSW	14	31155765	missense	probably damaging	1.00
R9570:Stab1	UTSW	14	31142681	missense	probably benign	0.01
R9624:Stab1	UTSW	14	31141388	missense
R9694:Stab1	UTSW	14	31154944	missense	probably benign	0.06
R9723:Stab1	UTSW	14	31163891	missense	probably benign	0.10
X0026:Stab1	UTSW	14	31162191	missense	possibly damaging	0.91
Z1176:Stab1	UTSW	14	31142038	missense	probably benign	0.00
Z1176:Stab1	UTSW	14	31150660	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTCAAAGGTCAAGTGCCGTTGC -3'
(R):5'- TCACACTGTTGCTCTACCCACAGG -3'

Sequencing Primer
(F):5'- TTGCACAATGTGGGCCTC -3'
(R):5'- GCCTTGCCTCCTGATAGAAAG -3'

Posted On

2013-04-24