Incidental Mutation 'R4109:Spire1'
ID317224
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Namespire type actin nucleation factor 1
Synonyms6030430B19Rik, Spir-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R4109 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67488209-67610790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67497217 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 338 (Q338R)
Ref Sequence ENSEMBL: ENSMUSP00000153492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045105
AA Change: Q466R

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: Q466R

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082243
AA Change: Q421R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: Q421R

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115050
AA Change: Q421R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: Q421R

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000224122
AA Change: Q166R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224659
Predicted Effect probably damaging
Transcript: ENSMUST00000224799
AA Change: Q338R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226000
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,295,103 D59E probably benign Het
Acads T C 5: 115,110,854 *302W probably null Het
Aldh1l1 A G 6: 90,562,644 E185G probably benign Het
Arhgap20 A G 9: 51,816,685 H66R possibly damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atg2a A G 19: 6,258,374 T1646A possibly damaging Het
Cd200r1 C G 16: 44,790,084 T185S possibly damaging Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Col1a2 A T 6: 4,510,705 R52* probably null Het
Eml5 T C 12: 98,841,548 probably null Het
Ifi206 T G 1: 173,480,988 T481P probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Nos1ap A T 1: 170,318,668 M439K probably benign Het
Paxbp1 T A 16: 91,016,898 T864S probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Satb1 A G 17: 51,804,350 V160A probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc1a7 T C 4: 107,968,661 V39A probably benign Het
Supt16 T C 14: 52,162,731 E985G probably damaging Het
Tmprss11f T C 5: 86,529,936 K325E possibly damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trav13-2 A C 14: 53,635,241 H58P probably benign Het
Trbv13-2 A T 6: 41,121,644 Y51F probably benign Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Zan G A 5: 137,458,619 T1285I unknown Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67529015 missense probably damaging 1.00
IGL01639:Spire1 APN 18 67545668 missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67506655 missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67491365 missense probably damaging 1.00
R0457:Spire1 UTSW 18 67552600 missense probably damaging 0.98
R0531:Spire1 UTSW 18 67491305 missense probably damaging 1.00
R0608:Spire1 UTSW 18 67528875 missense probably damaging 0.99
R2098:Spire1 UTSW 18 67503466 missense probably damaging 0.99
R2299:Spire1 UTSW 18 67530423 missense probably damaging 1.00
R3028:Spire1 UTSW 18 67491347 missense probably damaging 1.00
R3815:Spire1 UTSW 18 67506663 missense probably benign 0.05
R4049:Spire1 UTSW 18 67529031 splice site probably null
R4050:Spire1 UTSW 18 67529031 splice site probably null
R4059:Spire1 UTSW 18 67545713 missense probably damaging 0.98
R4700:Spire1 UTSW 18 67512865 missense probably benign 0.01
R4941:Spire1 UTSW 18 67519314 missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67552779 splice site probably null
R5363:Spire1 UTSW 18 67506555 missense probably damaging 1.00
R5561:Spire1 UTSW 18 67506646 missense probably damaging 0.96
R5795:Spire1 UTSW 18 67495195 missense probably benign
R5952:Spire1 UTSW 18 67506709 missense probably benign 0.00
R5982:Spire1 UTSW 18 67497316 critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67519880 missense probably damaging 1.00
R7559:Spire1 UTSW 18 67501117 missense probably benign 0.04
R8006:Spire1 UTSW 18 67501181 nonsense probably null
R8111:Spire1 UTSW 18 67519321 missense probably damaging 0.98
R8675:Spire1 UTSW 18 67491308 missense possibly damaging 0.48
T0970:Spire1 UTSW 18 67501063 splice site probably null
Z1088:Spire1 UTSW 18 67495152 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTTCCACTAATTTTGCCAAGGGAG -3'
(R):5'- TTTGAAGGGAGCACAGCTGC -3'

Sequencing Primer
(F):5'- CAAAAATCCCCTCTTGTAAAATGAGG -3'
(R):5'- GCACAGCTGCTCCAGAG -3'
Posted On2015-05-15