Mutagenetix > Incidental Mutation

Incidental Mutation 'R4110:Cse1l'

317238

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

040988-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4110 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 166942050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 488 (Y488H)

Ref Sequence

ENSEMBL: ENSMUSP00000126757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

probably benign
Transcript: ENSMUST00000002790
AA Change: Y801H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: Y801H

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145819

Predicted Effect

probably benign
Transcript: ENSMUST00000163437
AA Change: Y488H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: Y488H

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163917

Predicted Effect

probably benign
Transcript: ENSMUST00000164974

SMART Domains

Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:CAS_CSE1	24	72	5.4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166871

Predicted Effect

probably benign
Transcript: ENSMUST00000168599
AA Change: Y745H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: Y745H

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169290

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172037

Meta Mutation Damage Score

0.1309

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.3%
20x: 95.6%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot10	A	T	15: 20,666,526	L43Q	probably damaging	Het
Alms1	G	A	6: 85,620,888	V1368I	probably benign	Het
Als2cl	T	C	9: 110,884,047	S2P	probably benign	Het
AW209491	T	C	13: 14,637,573	V337A	probably damaging	Het
Bace2	A	G	16: 97,436,656	T436A	probably benign	Het
BC023105	A	G	18: 60,442,284		noncoding transcript	Het
Blvra	T	C	2: 127,095,155	V176A	probably damaging	Het
Casp2	G	A	6: 42,267,894	A76T	probably damaging	Het
Ccdc88c	A	G	12: 100,945,073	L34P	probably damaging	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Col6a2	T	A	10: 76,606,169		probably null	Het
Dip2c	G	T	13: 9,637,101	G1254C	probably damaging	Het
Dnajb12	T	A	10: 59,894,314	S270R	possibly damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Dscaml1	G	A	9: 45,732,068	A1262T	probably benign	Het
Dtwd2	A	C	18: 49,698,306		probably benign	Het
Fadd	C	A	7: 144,580,751	K132N	possibly damaging	Het
Fndc3c1	T	C	X: 106,444,291	N462S	probably benign	Het
Fzd3	A	G	14: 65,235,167	V384A	probably benign	Het
Gm6370	T	C	5: 146,493,892	S296P	probably benign	Het
Gm853	A	T	4: 130,219,174	L143Q	probably damaging	Het
Gsdmc	T	A	15: 63,780,027	H245L	probably benign	Het
H13	T	C	2: 152,681,109	I114T	probably damaging	Het
Hhipl2	A	G	1: 183,424,012	R78G	probably benign	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Man2c1	A	G	9: 57,136,771	N330S	probably damaging	Het
Muc19	T	A	15: 91,897,622		noncoding transcript	Het
Myh14	T	G	7: 44,628,550	M1092L	probably benign	Het
Neb	A	G	2: 52,148,766	I2899T	probably benign	Het
Neb	T	A	2: 52,244,125	Q3282L	probably damaging	Het
Nqo2	A	T	13: 33,979,637	Q93L	probably benign	Het
Olfr1239	C	A	2: 89,418,100	L104F	probably benign	Het
Olfr46	C	A	7: 140,610,264	L33M	probably benign	Het
Olfr46	T	A	7: 140,610,265	L33Q	possibly damaging	Het
Olfr641	T	C	7: 104,040,402	V202A	probably damaging	Het
Pcsk1	A	G	13: 75,096,369	N122S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,864	I966V	probably benign	Het
Phldb1	G	A	9: 44,715,831	T439I	possibly damaging	Het
Pign	A	G	1: 105,553,815		probably benign	Het
Pkn1	A	T	8: 83,691,199	D120E	probably benign	Het
Ptpru	A	G	4: 131,819,037	Y301H	probably damaging	Het
Raly	C	T	2: 154,857,458	Q61*	probably null	Het
Rpl24	T	C	16: 55,971,360	V148A	probably benign	Het
S100a16	A	G	3: 90,542,072	N18S	probably damaging	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Sgca	T	C	11: 94,972,570	T27A	possibly damaging	Het
Slc22a12	C	A	19: 6,540,628	R203L	probably damaging	Het
Ssbp3	C	A	4: 107,047,196		probably benign	Het
Sucnr1	C	G	3: 60,086,794	R248G	probably damaging	Het
Tbr1	C	T	2: 61,811,732	P184L	probably benign	Het
Thsd7b	A	T	1: 130,116,619	D1112V	probably benign	Het
Tnc	A	G	4: 64,014,951	V692A	probably damaging	Het
Top2a	C	A	11: 99,022,960	K18N	probably damaging	Het
Topbp1	G	T	9: 103,309,959	R121L	probably damaging	Het
Unc79	T	C	12: 103,059,370	C339R	probably damaging	Het
Wdfy3	C	T	5: 101,900,058		probably null	Het
Zbtb3	G	C	19: 8,803,020		probably benign	Het
Zfp715	T	A	7: 43,297,880	K885N	possibly damaging	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973	missense	possibly damaging	0.95
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign
R9600:Cse1l	UTSW	2	166915199	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGTGATACAAACATGGGGC -3'
(R):5'- AAGACTTTGGGAATGTGGACATC -3'

Sequencing Primer
(F):5'- TGTGATACAAACATGGGGCCTCTC -3'
(R):5'- GGAATGTGGACATCAGCTTTTC -3'

Posted On

2015-05-15