Incidental Mutation 'R4110:Cse1l'
ID 317238
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
MMRRC Submission 040988-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4110 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 166783970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 488 (Y488H)
Ref Sequence ENSEMBL: ENSMUSP00000126757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: Y801H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: Y801H

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145819
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: Y488H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: Y488H

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163917
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166871
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: Y745H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: Y745H

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172037
Meta Mutation Damage Score 0.1309 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Acot10 A T 15: 20,666,612 (GRCm39) L43Q probably damaging Het
Alms1 G A 6: 85,597,870 (GRCm39) V1368I probably benign Het
Als2cl T C 9: 110,713,115 (GRCm39) S2P probably benign Het
AW209491 T C 13: 14,812,158 (GRCm39) V337A probably damaging Het
Bace2 A G 16: 97,237,856 (GRCm39) T436A probably benign Het
BC023105 A G 18: 60,575,356 (GRCm39) noncoding transcript Het
Blvra T C 2: 126,937,075 (GRCm39) V176A probably damaging Het
Casp2 G A 6: 42,244,828 (GRCm39) A76T probably damaging Het
Ccdc88c A G 12: 100,911,332 (GRCm39) L34P probably damaging Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Col6a2 T A 10: 76,442,003 (GRCm39) probably null Het
Dip2c G T 13: 9,687,137 (GRCm39) G1254C probably damaging Het
Dnajb12 T A 10: 59,730,136 (GRCm39) S270R possibly damaging Het
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Dscaml1 G A 9: 45,643,366 (GRCm39) A1262T probably benign Het
Dtwd2 A C 18: 49,831,373 (GRCm39) probably benign Het
Fadd C A 7: 144,134,488 (GRCm39) K132N possibly damaging Het
Fndc3c1 T C X: 105,487,897 (GRCm39) N462S probably benign Het
Fzd3 A G 14: 65,472,616 (GRCm39) V384A probably benign Het
Gm6370 T C 5: 146,430,702 (GRCm39) S296P probably benign Het
Gsdmc T A 15: 63,651,876 (GRCm39) H245L probably benign Het
H13 T C 2: 152,523,029 (GRCm39) I114T probably damaging Het
Hhipl2 A G 1: 183,204,920 (GRCm39) R78G probably benign Het
Hrh3 C A 2: 179,744,643 (GRCm39) R99L possibly damaging Het
Ldc1 A T 4: 130,112,967 (GRCm39) L143Q probably damaging Het
Man2c1 A G 9: 57,044,055 (GRCm39) N330S probably damaging Het
Muc19 T A 15: 91,781,816 (GRCm39) noncoding transcript Het
Myh14 T G 7: 44,277,974 (GRCm39) M1092L probably benign Het
Neb A G 2: 52,038,778 (GRCm39) I2899T probably benign Het
Neb T A 2: 52,134,137 (GRCm39) Q3282L probably damaging Het
Nqo2 A T 13: 34,163,620 (GRCm39) Q93L probably benign Het
Or13a18 T A 7: 140,190,178 (GRCm39) L33Q possibly damaging Het
Or13a18 C A 7: 140,190,177 (GRCm39) L33M probably benign Het
Or4a2 C A 2: 89,248,444 (GRCm39) L104F probably benign Het
Or51i2 T C 7: 103,689,609 (GRCm39) V202A probably damaging Het
Pcsk1 A G 13: 75,244,488 (GRCm39) N122S probably damaging Het
Pdzrn4 A G 15: 92,668,745 (GRCm39) I966V probably benign Het
Phldb1 G A 9: 44,627,128 (GRCm39) T439I possibly damaging Het
Pign A G 1: 105,481,540 (GRCm39) probably benign Het
Pkn1 A T 8: 84,417,828 (GRCm39) D120E probably benign Het
Ptpru A G 4: 131,546,348 (GRCm39) Y301H probably damaging Het
Raly C T 2: 154,699,378 (GRCm39) Q61* probably null Het
Rpl24 T C 16: 55,791,723 (GRCm39) V148A probably benign Het
S100a16 A G 3: 90,449,379 (GRCm39) N18S probably damaging Het
Sec31b G T 19: 44,512,968 (GRCm39) T507N possibly damaging Het
Sgca T C 11: 94,863,396 (GRCm39) T27A possibly damaging Het
Slc22a12 C A 19: 6,590,658 (GRCm39) R203L probably damaging Het
Ssbp3 C A 4: 106,904,393 (GRCm39) probably benign Het
Sucnr1 C G 3: 59,994,215 (GRCm39) R248G probably damaging Het
Tbr1 C T 2: 61,642,076 (GRCm39) P184L probably benign Het
Thsd7b A T 1: 130,044,356 (GRCm39) D1112V probably benign Het
Tnc A G 4: 63,933,188 (GRCm39) V692A probably damaging Het
Top2a C A 11: 98,913,786 (GRCm39) K18N probably damaging Het
Topbp1 G T 9: 103,187,158 (GRCm39) R121L probably damaging Het
Unc79 T C 12: 103,025,629 (GRCm39) C339R probably damaging Het
Wdfy3 C T 5: 102,047,924 (GRCm39) probably null Het
Zbtb3 G C 19: 8,780,384 (GRCm39) probably benign Het
Zfp715 T A 7: 42,947,304 (GRCm39) K885N possibly damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGATACAAACATGGGGC -3'
(R):5'- AAGACTTTGGGAATGTGGACATC -3'

Sequencing Primer
(F):5'- TGTGATACAAACATGGGGCCTCTC -3'
(R):5'- GGAATGTGGACATCAGCTTTTC -3'
Posted On 2015-05-15