Mutagenetix > Incidental Mutation

Incidental Mutation 'R4110:Pdzrn4'

317275

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

040988-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R4110 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92770864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 966 (I966V)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000035399
AA Change: I727V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: I727V

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169942
AA Change: I966V

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: I966V

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.0750

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.3%
20x: 95.6%

Validation Efficiency

100% (61/61)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot10	A	T	15: 20,666,526	L43Q	probably damaging	Het
Alms1	G	A	6: 85,620,888	V1368I	probably benign	Het
Als2cl	T	C	9: 110,884,047	S2P	probably benign	Het
AW209491	T	C	13: 14,637,573	V337A	probably damaging	Het
Bace2	A	G	16: 97,436,656	T436A	probably benign	Het
BC023105	A	G	18: 60,442,284		noncoding transcript	Het
Blvra	T	C	2: 127,095,155	V176A	probably damaging	Het
Casp2	G	A	6: 42,267,894	A76T	probably damaging	Het
Ccdc88c	A	G	12: 100,945,073	L34P	probably damaging	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Col6a2	T	A	10: 76,606,169		probably null	Het
Cse1l	T	C	2: 166,942,050	Y488H	probably benign	Het
Dip2c	G	T	13: 9,637,101	G1254C	probably damaging	Het
Dnajb12	T	A	10: 59,894,314	S270R	possibly damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Dscaml1	G	A	9: 45,732,068	A1262T	probably benign	Het
Dtwd2	A	C	18: 49,698,306		probably benign	Het
Fadd	C	A	7: 144,580,751	K132N	possibly damaging	Het
Fndc3c1	T	C	X: 106,444,291	N462S	probably benign	Het
Fzd3	A	G	14: 65,235,167	V384A	probably benign	Het
Gm6370	T	C	5: 146,493,892	S296P	probably benign	Het
Gm853	A	T	4: 130,219,174	L143Q	probably damaging	Het
Gsdmc	T	A	15: 63,780,027	H245L	probably benign	Het
H13	T	C	2: 152,681,109	I114T	probably damaging	Het
Hhipl2	A	G	1: 183,424,012	R78G	probably benign	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Man2c1	A	G	9: 57,136,771	N330S	probably damaging	Het
Muc19	T	A	15: 91,897,622		noncoding transcript	Het
Myh14	T	G	7: 44,628,550	M1092L	probably benign	Het
Neb	A	G	2: 52,148,766	I2899T	probably benign	Het
Neb	T	A	2: 52,244,125	Q3282L	probably damaging	Het
Nqo2	A	T	13: 33,979,637	Q93L	probably benign	Het
Olfr1239	C	A	2: 89,418,100	L104F	probably benign	Het
Olfr46	C	A	7: 140,610,264	L33M	probably benign	Het
Olfr46	T	A	7: 140,610,265	L33Q	possibly damaging	Het
Olfr641	T	C	7: 104,040,402	V202A	probably damaging	Het
Pcsk1	A	G	13: 75,096,369	N122S	probably damaging	Het
Phldb1	G	A	9: 44,715,831	T439I	possibly damaging	Het
Pign	A	G	1: 105,553,815		probably benign	Het
Pkn1	A	T	8: 83,691,199	D120E	probably benign	Het
Ptpru	A	G	4: 131,819,037	Y301H	probably damaging	Het
Raly	C	T	2: 154,857,458	Q61*	probably null	Het
Rpl24	T	C	16: 55,971,360	V148A	probably benign	Het
S100a16	A	G	3: 90,542,072	N18S	probably damaging	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Sgca	T	C	11: 94,972,570	T27A	possibly damaging	Het
Slc22a12	C	A	19: 6,540,628	R203L	probably damaging	Het
Ssbp3	C	A	4: 107,047,196		probably benign	Het
Sucnr1	C	G	3: 60,086,794	R248G	probably damaging	Het
Tbr1	C	T	2: 61,811,732	P184L	probably benign	Het
Thsd7b	A	T	1: 130,116,619	D1112V	probably benign	Het
Tnc	A	G	4: 64,014,951	V692A	probably damaging	Het
Top2a	C	A	11: 99,022,960	K18N	probably damaging	Het
Topbp1	G	T	9: 103,309,959	R121L	probably damaging	Het
Unc79	T	C	12: 103,059,370	C339R	probably damaging	Het
Wdfy3	C	T	5: 101,900,058		probably null	Het
Zbtb3	G	C	19: 8,803,020		probably benign	Het
Zfp715	T	A	7: 43,297,880	K885N	possibly damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GAACGTGCCTTAAAGATCAAGG -3'
(R):5'- AAGCCAGTTGTCCCCATGTG -3'

Sequencing Primer
(F):5'- TGGCATGACCACAGACGACG -3'
(R):5'- CCCATGTGTCTGGTCATACGG -3'

Posted On

2015-05-15