Incidental Mutation 'R4111:Pask'
ID317287
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene NamePAS domain containing serine/threonine kinase
SynonymsPaskin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4111 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93308770-93343482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93310818 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1315 (V1315A)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027492] [ENSMUST00000027493] [ENSMUST00000112942] [ENSMUST00000112944]
Predicted Effect probably benign
Transcript: ENSMUST00000027492
SMART Domains Protein: ENSMUSP00000027492
Gene: ENSMUSG00000026273

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Mterf 142 172 1.28e2 SMART
Mterf 177 208 1.1e1 SMART
Mterf 213 244 3.89e0 SMART
Mterf 246 274 2.06e2 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000027493
AA Change: V1315A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: V1315A

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112942
SMART Domains Protein: ENSMUSP00000108564
Gene: ENSMUSG00000026273

DomainStartEndE-ValueType
PDB:4FP9|H 50 235 7e-55 PDB
Blast:Mterf 142 167 1e-7 BLAST
Blast:Mterf 178 208 8e-13 BLAST
Blast:Mterf 213 235 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112944
SMART Domains Protein: ENSMUSP00000108566
Gene: ENSMUSG00000026273

DomainStartEndE-ValueType
PDB:4FP9|H 50 235 6e-54 PDB
Blast:Mterf 142 167 6e-8 BLAST
Blast:Mterf 178 208 2e-12 BLAST
Blast:Mterf 213 235 1e-7 BLAST
low complexity region 253 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189856
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Ambra1 T C 2: 91,900,558 S894P probably damaging Het
Arhgef12 C A 9: 42,972,274 G1320C probably damaging Het
Atg7 G C 6: 114,713,294 G596R probably damaging Het
AY761184 T C 8: 21,702,663 T106A possibly damaging Het
Birc6 T C 17: 74,566,015 V423A probably damaging Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Ctu2 G A 8: 122,476,517 R24Q possibly damaging Het
Dclk3 T C 9: 111,469,080 I564T probably damaging Het
Ddx39b T A 17: 35,243,364 I42N possibly damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dzip1 T A 14: 118,877,233 K837* probably null Het
Epha1 G A 6: 42,358,838 T955M possibly damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12355 A T 11: 98,625,397 V50D probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gpr37l1 T C 1: 135,167,270 T79A possibly damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Ifnar1 C A 16: 91,496,158 P230T probably damaging Het
Impact T C 18: 12,976,033 probably null Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Lrpprc G A 17: 84,726,338 T1037M probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr1440 T C 19: 12,394,301 F13L probably damaging Het
Olfr430 T A 1: 174,069,433 I45N probably damaging Het
Olfr979 C A 9: 40,000,898 E110* probably null Het
Pramef25 T A 4: 143,949,905 I210F possibly damaging Het
Prl7a2 A T 13: 27,665,067 Y80N possibly damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rtn2 T C 7: 19,286,844 S81P probably damaging Het
Sbf2 G A 7: 110,428,242 P470S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sox30 A G 11: 46,017,214 Y736C probably benign Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Tns1 T C 1: 73,941,932 N1091S probably damaging Het
Trappc10 A G 10: 78,196,430 F1008S probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Uhrf1bp1 T A 17: 27,886,090 L586* probably null Het
Vmn1r122 A T 7: 21,133,513 S206T probably damaging Het
Vmn2r1 A C 3: 64,089,755 K277N probably benign Het
Vps13a T C 19: 16,640,628 E2931G probably damaging Het
Wdr70 G T 15: 7,976,991 Q360K probably benign Het
Wdr90 G T 17: 25,849,368 Q1329K possibly damaging Het
Wrn T C 8: 33,352,155 N37S probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp964 T A 8: 69,664,104 S450R probably benign Het
Zkscan2 T C 7: 123,482,684 probably benign Het
Zmynd10 A T 9: 107,549,052 K133* probably null Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93310852 missense probably benign 0.02
IGL01620:Pask APN 1 93310122 missense possibly damaging 0.87
IGL01959:Pask APN 1 93334607 missense probably benign 0.03
IGL02170:Pask APN 1 93310884 missense possibly damaging 0.69
IGL02499:Pask APN 1 93321095 nonsense probably null
IGL02670:Pask APN 1 93310818 missense probably damaging 1.00
IGL03066:Pask APN 1 93330866 missense probably benign 0.02
IGL03210:Pask APN 1 93319992 missense possibly damaging 0.92
R0472:Pask UTSW 1 93320917 missense probably benign 0.00
R0524:Pask UTSW 1 93310834 missense probably damaging 1.00
R0854:Pask UTSW 1 93327400 missense probably damaging 0.99
R0854:Pask UTSW 1 93327412 missense probably damaging 1.00
R0854:Pask UTSW 1 93327434 missense possibly damaging 0.79
R0863:Pask UTSW 1 93314339 missense probably damaging 1.00
R1052:Pask UTSW 1 93330827 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1831:Pask UTSW 1 93320769 splice site probably null
R1958:Pask UTSW 1 93321458 missense probably benign 0.00
R2143:Pask UTSW 1 93321297 missense probably benign 0.00
R2144:Pask UTSW 1 93321297 missense probably benign 0.00
R2145:Pask UTSW 1 93321297 missense probably benign 0.00
R2509:Pask UTSW 1 93330763 missense possibly damaging 0.62
R2858:Pask UTSW 1 93321651 missense probably benign 0.00
R2899:Pask UTSW 1 93334547 missense probably damaging 1.00
R3545:Pask UTSW 1 93317115 missense probably damaging 1.00
R3778:Pask UTSW 1 93327467 missense probably damaging 1.00
R4514:Pask UTSW 1 93322133 missense probably benign 0.03
R4527:Pask UTSW 1 93320502 missense probably benign
R4580:Pask UTSW 1 93322108 missense probably benign 0.36
R4718:Pask UTSW 1 93322196 missense possibly damaging 0.67
R4775:Pask UTSW 1 93337524 missense probably damaging 0.97
R5036:Pask UTSW 1 93322079 nonsense probably null
R5070:Pask UTSW 1 93330874 missense probably damaging 1.00
R5084:Pask UTSW 1 93322097 missense probably benign
R5151:Pask UTSW 1 93334628 missense probably damaging 1.00
R5196:Pask UTSW 1 93310083 unclassified probably benign
R5643:Pask UTSW 1 93337343 critical splice donor site probably null
R5739:Pask UTSW 1 93322056 missense probably benign
R6126:Pask UTSW 1 93314359 missense probably damaging 1.00
R7161:Pask UTSW 1 93310905 missense probably benign
R7284:Pask UTSW 1 93320669 missense probably benign 0.01
R7289:Pask UTSW 1 93331587 missense probably damaging 1.00
R8277:Pask UTSW 1 93325363 critical splice donor site probably null
R8303:Pask UTSW 1 93320564 missense probably benign 0.10
R8309:Pask UTSW 1 93312851 nonsense probably null
R8321:Pask UTSW 1 93320655 missense possibly damaging 0.85
Z1088:Pask UTSW 1 93316801 missense probably damaging 1.00
Z1177:Pask UTSW 1 93335732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCTCTGCATAATCAAGCC -3'
(R):5'- CTGTGAGGCAGGATAGCTTG -3'

Sequencing Primer
(F):5'- AATCAAGCCCTATTTTTCAGGCCAG -3'
(R):5'- GCAGGATAGCTTGAAATCTATAGGTC -3'
Posted On2015-05-15