Incidental Mutation 'R4111:Olfr430'
ID317289
Institutional Source Beutler Lab
Gene Symbol Olfr430
Ensembl Gene ENSMUSG00000050134
Gene Nameolfactory receptor 430
SynonymsGA_x6K02T2P20D-21108443-21107490, MOR105-5P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4111 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174066605-174072273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 174069433 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 45 (I45N)
Ref Sequence ENSEMBL: ENSMUSP00000150930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055873] [ENSMUST00000213425] [ENSMUST00000214390]
Predicted Effect probably damaging
Transcript: ENSMUST00000055873
AA Change: I45N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130615
Gene: ENSMUSG00000050134
AA Change: I45N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-65 PFAM
Pfam:7tm_1 41 290 9.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213425
AA Change: I45N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214390
AA Change: I45N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Ambra1 T C 2: 91,900,558 S894P probably damaging Het
Arhgef12 C A 9: 42,972,274 G1320C probably damaging Het
Atg7 G C 6: 114,713,294 G596R probably damaging Het
AY761184 T C 8: 21,702,663 T106A possibly damaging Het
Birc6 T C 17: 74,566,015 V423A probably damaging Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Ctu2 G A 8: 122,476,517 R24Q possibly damaging Het
Dclk3 T C 9: 111,469,080 I564T probably damaging Het
Ddx39b T A 17: 35,243,364 I42N possibly damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dzip1 T A 14: 118,877,233 K837* probably null Het
Epha1 G A 6: 42,358,838 T955M possibly damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12355 A T 11: 98,625,397 V50D probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gpr37l1 T C 1: 135,167,270 T79A possibly damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Ifnar1 C A 16: 91,496,158 P230T probably damaging Het
Impact T C 18: 12,976,033 probably null Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Lrpprc G A 17: 84,726,338 T1037M probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr1440 T C 19: 12,394,301 F13L probably damaging Het
Olfr979 C A 9: 40,000,898 E110* probably null Het
Pask A G 1: 93,310,818 V1315A probably damaging Het
Pramef25 T A 4: 143,949,905 I210F possibly damaging Het
Prl7a2 A T 13: 27,665,067 Y80N possibly damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rtn2 T C 7: 19,286,844 S81P probably damaging Het
Sbf2 G A 7: 110,428,242 P470S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sox30 A G 11: 46,017,214 Y736C probably benign Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Tns1 T C 1: 73,941,932 N1091S probably damaging Het
Trappc10 A G 10: 78,196,430 F1008S probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Uhrf1bp1 T A 17: 27,886,090 L586* probably null Het
Vmn1r122 A T 7: 21,133,513 S206T probably damaging Het
Vmn2r1 A C 3: 64,089,755 K277N probably benign Het
Vps13a T C 19: 16,640,628 E2931G probably damaging Het
Wdr70 G T 15: 7,976,991 Q360K probably benign Het
Wdr90 G T 17: 25,849,368 Q1329K possibly damaging Het
Wrn T C 8: 33,352,155 N37S probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp964 T A 8: 69,664,104 S450R probably benign Het
Zkscan2 T C 7: 123,482,684 probably benign Het
Zmynd10 A T 9: 107,549,052 K133* probably null Het
Other mutations in Olfr430
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr430 APN 1 174070066 missense probably benign 0.00
IGL02279:Olfr430 APN 1 174069391 missense probably null 1.00
IGL02537:Olfr430 APN 1 174069454 missense possibly damaging 0.63
R0323:Olfr430 UTSW 1 174069327 missense probably benign
R0627:Olfr430 UTSW 1 174070077 missense probably damaging 1.00
R1079:Olfr430 UTSW 1 174069466 missense possibly damaging 0.95
R1757:Olfr430 UTSW 1 174069658 missense probably damaging 1.00
R1902:Olfr430 UTSW 1 174070126 missense probably damaging 0.96
R3804:Olfr430 UTSW 1 174069908 missense probably damaging 1.00
R3927:Olfr430 UTSW 1 174069312 missense probably damaging 1.00
R3930:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R3931:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R4210:Olfr430 UTSW 1 174070008 missense probably damaging 0.98
R4383:Olfr430 UTSW 1 174069477 missense probably benign 0.34
R4651:Olfr430 UTSW 1 174069828 missense possibly damaging 0.54
R5097:Olfr430 UTSW 1 174069529 missense probably benign 0.22
R5385:Olfr430 UTSW 1 174069470 missense probably benign 0.31
R5722:Olfr430 UTSW 1 174069870 missense probably damaging 1.00
R6608:Olfr430 UTSW 1 174069729 missense probably benign 0.00
R6643:Olfr430 UTSW 1 174070045 missense probably damaging 1.00
R7316:Olfr430 UTSW 1 174070161 missense probably benign 0.00
R7532:Olfr430 UTSW 1 174070098 missense probably benign 0.37
Z1088:Olfr430 UTSW 1 174069949 missense probably damaging 1.00
Z1176:Olfr430 UTSW 1 174069331 missense probably damaging 1.00
Z1176:Olfr430 UTSW 1 174069514 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCAATCCCTCTAATTTGGTTC -3'
(R):5'- CATGGCTGTAAGAAGGTAGCATTC -3'

Sequencing Primer
(F):5'- AATCCCTCTAATTTGGTTCTTCAAC -3'
(R):5'- GTAGCATTCAGAGGCCCCAAG -3'
Posted On2015-05-15