Incidental Mutation 'R4111:Pramef25'
ID 317299
Institutional Source Beutler Lab
Gene Symbol Pramef25
Ensembl Gene ENSMUSG00000078511
Gene Name PRAME family member 25
Synonyms Gm13109
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R4111 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 143948580-143951016 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143949905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 210 (I210F)
Ref Sequence ENSEMBL: ENSMUSP00000101392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105766]
AlphaFold A2ASI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000105766
AA Change: I210F

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101392
Gene: ENSMUSG00000078511
AA Change: I210F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 427 2e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Ambra1 T C 2: 91,900,558 S894P probably damaging Het
Arhgef12 C A 9: 42,972,274 G1320C probably damaging Het
Atg7 G C 6: 114,713,294 G596R probably damaging Het
AY761184 T C 8: 21,702,663 T106A possibly damaging Het
Birc6 T C 17: 74,566,015 V423A probably damaging Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Ctu2 G A 8: 122,476,517 R24Q possibly damaging Het
Dclk3 T C 9: 111,469,080 I564T probably damaging Het
Ddx39b T A 17: 35,243,364 I42N possibly damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dzip1 T A 14: 118,877,233 K837* probably null Het
Epha1 G A 6: 42,358,838 T955M possibly damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12355 A T 11: 98,625,397 V50D probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gpr37l1 T C 1: 135,167,270 T79A possibly damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Ifnar1 C A 16: 91,496,158 P230T probably damaging Het
Impact T C 18: 12,976,033 probably null Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Lrpprc G A 17: 84,726,338 T1037M probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr1440 T C 19: 12,394,301 F13L probably damaging Het
Olfr430 T A 1: 174,069,433 I45N probably damaging Het
Olfr979 C A 9: 40,000,898 E110* probably null Het
Pask A G 1: 93,310,818 V1315A probably damaging Het
Prl7a2 A T 13: 27,665,067 Y80N possibly damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rtn2 T C 7: 19,286,844 S81P probably damaging Het
Sbf2 G A 7: 110,428,242 P470S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sox30 A G 11: 46,017,214 Y736C probably benign Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Tns1 T C 1: 73,941,932 N1091S probably damaging Het
Trappc10 A G 10: 78,196,430 F1008S probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Uhrf1bp1 T A 17: 27,886,090 L586* probably null Het
Vmn1r122 A T 7: 21,133,513 S206T probably damaging Het
Vmn2r1 A C 3: 64,089,755 K277N probably benign Het
Vps13a T C 19: 16,640,628 E2931G probably damaging Het
Wdr70 G T 15: 7,976,991 Q360K probably benign Het
Wdr90 G T 17: 25,849,368 Q1329K possibly damaging Het
Wrn T C 8: 33,352,155 N37S probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp964 T A 8: 69,664,104 S450R probably benign Het
Zkscan2 T C 7: 123,482,684 probably benign Het
Zmynd10 A T 9: 107,549,052 K133* probably null Het
Other mutations in Pramef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Pramef25 APN 4 143950214 splice site probably benign
IGL01562:Pramef25 APN 4 143950865 missense probably damaging 1.00
IGL02422:Pramef25 APN 4 143949883 missense probably benign 0.25
IGL02632:Pramef25 APN 4 143949937 missense possibly damaging 0.84
IGL02745:Pramef25 APN 4 143950724 missense probably damaging 1.00
IGL02808:Pramef25 APN 4 143951015 utr 5 prime probably benign
IGL02883:Pramef25 APN 4 143949848 missense possibly damaging 0.64
IGL02961:Pramef25 APN 4 143949147 missense probably damaging 1.00
IGL03092:Pramef25 APN 4 143950197 missense probably damaging 0.97
FR4340:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949757 frame shift probably null
R0533:Pramef25 UTSW 4 143950720 missense possibly damaging 0.85
R0606:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R1624:Pramef25 UTSW 4 143949830 missense possibly damaging 0.47
R1898:Pramef25 UTSW 4 143950728 missense probably damaging 1.00
R2029:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2894:Pramef25 UTSW 4 143949122 missense probably damaging 1.00
R4298:Pramef25 UTSW 4 143949143 nonsense probably null
R4360:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R4361:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R5137:Pramef25 UTSW 4 143949120 missense probably benign 0.08
R5195:Pramef25 UTSW 4 143950880 missense probably damaging 0.99
R5312:Pramef25 UTSW 4 143949095 missense possibly damaging 0.96
R5548:Pramef25 UTSW 4 143949980 missense probably benign 0.24
R5591:Pramef25 UTSW 4 143948807 missense probably damaging 1.00
R5644:Pramef25 UTSW 4 143948804 missense probably benign 0.01
R6018:Pramef25 UTSW 4 143950899 missense possibly damaging 0.61
R6177:Pramef25 UTSW 4 143949006 missense possibly damaging 0.51
R6335:Pramef25 UTSW 4 143949032 missense probably benign 0.02
R6376:Pramef25 UTSW 4 143950697 missense probably benign 0.03
R6572:Pramef25 UTSW 4 143949692 missense probably benign 0.01
R6845:Pramef25 UTSW 4 143949824 missense probably benign
R6939:Pramef25 UTSW 4 143948796 missense probably benign 0.09
R7081:Pramef25 UTSW 4 143949278 missense probably damaging 1.00
R7505:Pramef25 UTSW 4 143949703 missense possibly damaging 0.94
R7711:Pramef25 UTSW 4 143949252 missense probably benign 0.22
R8284:Pramef25 UTSW 4 143950125 missense possibly damaging 0.95
R8297:Pramef25 UTSW 4 143949120 missense probably benign 0.08
R8299:Pramef25 UTSW 4 143950757 missense probably benign 0.24
R8700:Pramef25 UTSW 4 143949131 missense possibly damaging 0.51
R9179:Pramef25 UTSW 4 143949724 missense probably benign 0.01
R9199:Pramef25 UTSW 4 143949086 missense probably damaging 1.00
R9214:Pramef25 UTSW 4 143949180 missense probably benign 0.00
R9411:Pramef25 UTSW 4 143949645 missense probably damaging 1.00
RF011:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
RF013:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
RF021:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
Z1176:Pramef25 UTSW 4 143950123 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAGGTTGAGATGCTGGAGAC -3'
(R):5'- TAGATATGCACTGAGGCGACG -3'

Sequencing Primer
(F):5'- CTGAGAAATGAACTTGGTGACACTC -3'
(R):5'- CGACGTTTAAAGGTGGTCACTGAC -3'
Posted On 2015-05-15