Mutagenetix > Incidental Mutation

Incidental Mutation 'R0391:Chd1'

31730

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

038597-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0391 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 15749894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 970 (G970C)

Ref Sequence

ENSEMBL: ENSMUSP00000134091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]

AlphaFold

P40201

Predicted Effect

probably damaging
Transcript: ENSMUST00000024627
AA Change: G970C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: G970C

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1234	1e-112	BLAST
PDB:4B4C\|A	1119	1320	1e-132	PDB
low complexity region	1325	1348	N/A	INTRINSIC
low complexity region	1377	1388	N/A	INTRINSIC
DUF4208	1396	1500	5.54e-51	SMART
low complexity region	1507	1516	N/A	INTRINSIC
low complexity region	1538	1549	N/A	INTRINSIC
low complexity region	1626	1650	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000173311
AA Change: G970C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: G970C

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1078	2e-38	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000174461
AA Change: G354C

SMART Domains

Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852
AA Change: G354C

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	148	3.6e-34	PFAM
low complexity region	172	184	N/A	INTRINSIC
HELICc	201	285	8.48e-25	SMART
Blast:DEXDc	340	516	1e-47	BLAST

Meta Mutation Damage Score

0.8350

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.8%

Validation Efficiency

97% (97/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	T	A	4: 122,701,177		probably benign	Het
Abcc2	G	A	19: 43,821,605		probably benign	Het
Abcc8	C	G	7: 46,122,173	G838A	probably damaging	Het
Akr1c21	G	A	13: 4,581,200	A245T	probably damaging	Het
Anapc15-ps	T	C	10: 95,673,277	E47G	probably damaging	Het
Apoa1	A	G	9: 46,229,842	T79A	probably benign	Het
Atp6v1b1	A	G	6: 83,756,921	H378R	possibly damaging	Het
C4b	A	G	17: 34,735,614		probably benign	Het
Catsperd	A	T	17: 56,662,821	E638D	probably benign	Het
Cckar	C	T	5: 53,706,253		probably null	Het
Cfap100	C	T	6: 90,405,339		probably benign	Het
Col14a1	A	G	15: 55,446,259		probably benign	Het
Col17a1	C	T	19: 47,663,824	V698M	probably damaging	Het
Cpeb1	T	C	7: 81,361,725	D156G	possibly damaging	Het
Cryl1	A	G	14: 57,303,775	Y151H	possibly damaging	Het
Csmd3	C	A	15: 47,657,573	V1881L	probably damaging	Het
Ctnnal1	C	T	4: 56,847,921	A73T	probably damaging	Het
Cyp2c37	T	C	19: 39,994,506	S180P	probably damaging	Het
Cyp2c54	T	C	19: 40,072,169	T123A	possibly damaging	Het
Dennd6b	T	C	15: 89,187,214	D304G	probably damaging	Het
Dnmt3l	T	C	10: 78,051,916		probably benign	Het
Eci1	G	A	17: 24,433,260		probably null	Het
Efhc1	A	G	1: 20,960,188	Y115C	probably damaging	Het
Ern1	T	A	11: 106,407,178	K706*	probably null	Het
Fam129c	T	A	8: 71,602,499		probably benign	Het
Ghrl	T	C	6: 113,719,338	E31G	probably damaging	Het
Gpr108	A	C	17: 57,243,101	V179G	probably benign	Het
Henmt1	A	G	3: 108,958,535		probably benign	Het
Ift172	A	G	5: 31,286,667	V69A	probably damaging	Het
Il17ra	T	C	6: 120,476,979		probably benign	Het
Il17rb	T	C	14: 30,004,347	N95D	probably benign	Het
Il17rb	G	T	14: 30,006,155		probably null	Het
Iqub	G	A	6: 24,446,155	L757F	probably benign	Het
Itpr1	T	C	6: 108,378,167	V473A	probably benign	Het
Itpr2	T	G	6: 146,229,773	N1978H	probably damaging	Het
Klk1b26	T	A	7: 44,012,727	F3Y	probably damaging	Het
Lars	A	G	18: 42,251,363	V50A	probably benign	Het
Lax1	G	T	1: 133,680,066	H312Q	probably benign	Het
Lctl	T	C	9: 64,122,314		probably benign	Het
Lrp2	T	A	2: 69,456,858	D3745V	probably damaging	Het
Lrp2	G	A	2: 69,460,337		probably benign	Het
Lvrn	A	T	18: 46,850,466	H92L	probably benign	Het
March1	A	G	8: 66,418,973	T385A	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mbd5	T	C	2: 49,272,416	V970A	possibly damaging	Het
Mccc1	A	G	3: 35,963,570		probably benign	Het
Mpp4	A	T	1: 59,143,829		probably benign	Het
Mrnip	G	A	11: 50,199,920	A304T	probably damaging	Het
Muc5b	T	C	7: 141,865,082	S3922P	possibly damaging	Het
Myh3	T	A	11: 67,096,507		probably benign	Het
Nbea	A	T	3: 56,037,277	H555Q	probably damaging	Het
Nlrp9c	A	T	7: 26,371,476		probably benign	Het
Nmur1	A	T	1: 86,387,678	V178E	probably damaging	Het
Nod2	T	G	8: 88,663,778	S238A	probably benign	Het
Ogfod1	A	T	8: 94,063,023	T451S	probably damaging	Het
Olfr145	G	A	9: 37,897,842	G146D	probably benign	Het
Olfr23	T	C	11: 73,941,109	F288L	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr716	T	A	7: 107,148,187	Y290*	probably null	Het
Pcdh20	T	C	14: 88,468,668	I399V	probably benign	Het
Pdlim1	G	T	19: 40,243,573	H120Q	probably damaging	Het
Plg	T	C	17: 12,419,081	V798A	probably damaging	Het
Polr2c	A	G	8: 94,857,775	I39V	possibly damaging	Het
Ppfia2	C	A	10: 106,830,714		probably benign	Het
Ppp1r3a	A	T	6: 14,719,697	I406N	probably benign	Het
Psg28	A	T	7: 18,426,173	M366K	probably benign	Het
Rad54b	T	C	4: 11,601,702	I419T	probably damaging	Het
Rnf43	A	G	11: 87,731,282	Q403R	possibly damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc28a3	A	G	13: 58,569,415		probably benign	Het
Smad2	A	T	18: 76,289,037		probably null	Het
Smad4	G	A	18: 73,658,649	P274S	probably benign	Het
Smchd1	A	T	17: 71,403,154	V906D	probably damaging	Het
Soat2	C	A	15: 102,158,753	R320S	possibly damaging	Het
Spata33	C	T	8: 123,221,887	A57V	probably damaging	Het
Stab1	A	G	14: 31,143,418	L1814P	probably benign	Het
Stab2	T	C	10: 86,947,144	K680R	probably benign	Het
Stil	A	G	4: 115,041,172		probably null	Het
Sympk	T	A	7: 19,046,849	L759H	probably benign	Het
Tet1	A	T	10: 62,814,546		probably null	Het
Tfpi2	A	T	6: 3,965,460	N117K	probably benign	Het
Tle3	A	G	9: 61,416,661	Y766C	probably damaging	Het
Trpt1	C	A	19: 6,997,930		probably null	Het
Tshz1	A	G	18: 84,016,049	F78S	possibly damaging	Het
Ttc1	T	C	11: 43,738,808	D177G	probably damaging	Het
Ttc13	T	A	8: 124,674,401	Y741F	probably damaging	Het
Ulk3	C	T	9: 57,594,832	S462L	probably benign	Het
Utrn	C	T	10: 12,525,333		probably benign	Het
V1rd19	A	C	7: 24,003,585	T159P	probably damaging	Het
Vars	T	C	17: 35,011,486	V515A	possibly damaging	Het
Vmn1r85	A	G	7: 13,084,588	Y210H	probably benign	Het
Vmn2r89	A	G	14: 51,455,978	T262A	probably damaging	Het
Vps53	G	A	11: 76,121,579	T209I	probably benign	Het
Wdfy2	T	C	14: 62,925,133	F95L	possibly damaging	Het
Wwp1	G	T	4: 19,627,911	S694Y	probably damaging	Het
Zbtb8b	T	A	4: 129,432,670	D201V	probably damaging	Het
Zmym5	A	C	14: 56,804,451	N123K	possibly damaging	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15732565	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15749865	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15754997	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17378569	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15770097	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17378596	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15770168	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15742173	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17390053	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15734273	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15730807	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15749500	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15770298	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15725281	missense	possibly damaging	0.70
Holly	UTSW	17	15726283	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17393567	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15725431	missense	probably benign
R0285:Chd1	UTSW	17	17374680	splice site	probably benign
R0326:Chd1	UTSW	17	15768566	missense	probably damaging	1.00
R0326:Chd1	UTSW	17	15768568	missense	probably benign
R0372:Chd1	UTSW	17	17387290	missense	probably benign	0.14
R0486:Chd1	UTSW	17	15734342	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15742288	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15758261	unclassified	probably benign
R0701:Chd1	UTSW	17	15725431	missense	probably benign
R0788:Chd1	UTSW	17	15707114	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15770241	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15725431	missense	probably benign
R1169:Chd1	UTSW	17	15735732	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15725312	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17387480	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15739507	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15743232	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17387271	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15770303	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15762486	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15731006	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15742294	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15731871	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15770027	nonsense	probably null
R4242:Chd1	UTSW	17	15770027	nonsense	probably null
R4354:Chd1	UTSW	17	17390001	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17377817	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15733124	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15768753	nonsense	probably null
R4840:Chd1	UTSW	17	15768754	missense	probably damaging	1.00
R4880:Chd1	UTSW	17	17374654	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15742231	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15762405	missense	probably benign
R5078:Chd1	UTSW	17	15726354	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15728198	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15735743	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15754951	missense	probably benign	0.01
R5304:Chd1	UTSW	17	15770268	missense	possibly damaging	0.55
R5307:Chd1	UTSW	17	15732570	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15738549	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17385613	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15754932	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17377773	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15758688	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15730203	splice site	probably null
R6373:Chd1	UTSW	17	15738636	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15730602	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17380988	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15738633	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15725430	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17387167	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15761366	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15706937	splice site	probably null
R7317:Chd1	UTSW	17	15742274	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15770237	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15749398	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15767475	missense	probably benign
R7763:Chd1	UTSW	17	15733041	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15761404	missense	probably benign
R8194:Chd1	UTSW	17	17374475	start gained	probably benign
R8261:Chd1	UTSW	17	17387542	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15769980	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15743211	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15762449	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15730845	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15742289	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15735714	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15768761	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15766347	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15768733	missense	probably damaging	1.00
Z1177:Chd1	UTSW	17	15747801	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGATACCACTGGGAAGACAGTGC -3'
(R):5'- ACTAGCTCAACCCTCAGCAGTGTG -3'

Sequencing Primer
(F):5'- GCTTGACTGTTACAGATAGATCGC -3'
(R):5'- GAGTCTCGGCTCTCTTCAGG -3'

Posted On

2013-04-24