Mutagenetix > Incidental Mutation

Incidental Mutation 'R0391:C4b'

31731

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

038597-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0391 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 34735614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably benign
Transcript: ENSMUST00000069507

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.8%

Validation Efficiency

97% (97/100)

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	T	A	4: 122,701,177		probably benign	Het
Abcc2	G	A	19: 43,821,605		probably benign	Het
Abcc8	C	G	7: 46,122,173	G838A	probably damaging	Het
Akr1c21	G	A	13: 4,581,200	A245T	probably damaging	Het
Anapc15-ps	T	C	10: 95,673,277	E47G	probably damaging	Het
Apoa1	A	G	9: 46,229,842	T79A	probably benign	Het
Atp6v1b1	A	G	6: 83,756,921	H378R	possibly damaging	Het
Catsperd	A	T	17: 56,662,821	E638D	probably benign	Het
Cckar	C	T	5: 53,706,253		probably null	Het
Cfap100	C	T	6: 90,405,339		probably benign	Het
Chd1	G	T	17: 15,749,894	G970C	probably damaging	Het
Col14a1	A	G	15: 55,446,259		probably benign	Het
Col17a1	C	T	19: 47,663,824	V698M	probably damaging	Het
Cpeb1	T	C	7: 81,361,725	D156G	possibly damaging	Het
Cryl1	A	G	14: 57,303,775	Y151H	possibly damaging	Het
Csmd3	C	A	15: 47,657,573	V1881L	probably damaging	Het
Ctnnal1	C	T	4: 56,847,921	A73T	probably damaging	Het
Cyp2c37	T	C	19: 39,994,506	S180P	probably damaging	Het
Cyp2c54	T	C	19: 40,072,169	T123A	possibly damaging	Het
Dennd6b	T	C	15: 89,187,214	D304G	probably damaging	Het
Dnmt3l	T	C	10: 78,051,916		probably benign	Het
Eci1	G	A	17: 24,433,260		probably null	Het
Efhc1	A	G	1: 20,960,188	Y115C	probably damaging	Het
Ern1	T	A	11: 106,407,178	K706*	probably null	Het
Fam129c	T	A	8: 71,602,499		probably benign	Het
Ghrl	T	C	6: 113,719,338	E31G	probably damaging	Het
Gpr108	A	C	17: 57,243,101	V179G	probably benign	Het
Henmt1	A	G	3: 108,958,535		probably benign	Het
Ift172	A	G	5: 31,286,667	V69A	probably damaging	Het
Il17ra	T	C	6: 120,476,979		probably benign	Het
Il17rb	T	C	14: 30,004,347	N95D	probably benign	Het
Il17rb	G	T	14: 30,006,155		probably null	Het
Iqub	G	A	6: 24,446,155	L757F	probably benign	Het
Itpr1	T	C	6: 108,378,167	V473A	probably benign	Het
Itpr2	T	G	6: 146,229,773	N1978H	probably damaging	Het
Klk1b26	T	A	7: 44,012,727	F3Y	probably damaging	Het
Lars	A	G	18: 42,251,363	V50A	probably benign	Het
Lax1	G	T	1: 133,680,066	H312Q	probably benign	Het
Lctl	T	C	9: 64,122,314		probably benign	Het
Lrp2	T	A	2: 69,456,858	D3745V	probably damaging	Het
Lrp2	G	A	2: 69,460,337		probably benign	Het
Lvrn	A	T	18: 46,850,466	H92L	probably benign	Het
March1	A	G	8: 66,418,973	T385A	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mbd5	T	C	2: 49,272,416	V970A	possibly damaging	Het
Mccc1	A	G	3: 35,963,570		probably benign	Het
Mpp4	A	T	1: 59,143,829		probably benign	Het
Mrnip	G	A	11: 50,199,920	A304T	probably damaging	Het
Muc5b	T	C	7: 141,865,082	S3922P	possibly damaging	Het
Myh3	T	A	11: 67,096,507		probably benign	Het
Nbea	A	T	3: 56,037,277	H555Q	probably damaging	Het
Nlrp9c	A	T	7: 26,371,476		probably benign	Het
Nmur1	A	T	1: 86,387,678	V178E	probably damaging	Het
Nod2	T	G	8: 88,663,778	S238A	probably benign	Het
Ogfod1	A	T	8: 94,063,023	T451S	probably damaging	Het
Olfr145	G	A	9: 37,897,842	G146D	probably benign	Het
Olfr23	T	C	11: 73,941,109	F288L	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr716	T	A	7: 107,148,187	Y290*	probably null	Het
Pcdh20	T	C	14: 88,468,668	I399V	probably benign	Het
Pdlim1	G	T	19: 40,243,573	H120Q	probably damaging	Het
Plg	T	C	17: 12,419,081	V798A	probably damaging	Het
Polr2c	A	G	8: 94,857,775	I39V	possibly damaging	Het
Ppfia2	C	A	10: 106,830,714		probably benign	Het
Ppp1r3a	A	T	6: 14,719,697	I406N	probably benign	Het
Psg28	A	T	7: 18,426,173	M366K	probably benign	Het
Rad54b	T	C	4: 11,601,702	I419T	probably damaging	Het
Rnf43	A	G	11: 87,731,282	Q403R	possibly damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc28a3	A	G	13: 58,569,415		probably benign	Het
Smad2	A	T	18: 76,289,037		probably null	Het
Smad4	G	A	18: 73,658,649	P274S	probably benign	Het
Smchd1	A	T	17: 71,403,154	V906D	probably damaging	Het
Soat2	C	A	15: 102,158,753	R320S	possibly damaging	Het
Spata33	C	T	8: 123,221,887	A57V	probably damaging	Het
Stab1	A	G	14: 31,143,418	L1814P	probably benign	Het
Stab2	T	C	10: 86,947,144	K680R	probably benign	Het
Stil	A	G	4: 115,041,172		probably null	Het
Sympk	T	A	7: 19,046,849	L759H	probably benign	Het
Tet1	A	T	10: 62,814,546		probably null	Het
Tfpi2	A	T	6: 3,965,460	N117K	probably benign	Het
Tle3	A	G	9: 61,416,661	Y766C	probably damaging	Het
Trpt1	C	A	19: 6,997,930		probably null	Het
Tshz1	A	G	18: 84,016,049	F78S	possibly damaging	Het
Ttc1	T	C	11: 43,738,808	D177G	probably damaging	Het
Ttc13	T	A	8: 124,674,401	Y741F	probably damaging	Het
Ulk3	C	T	9: 57,594,832	S462L	probably benign	Het
Utrn	C	T	10: 12,525,333		probably benign	Het
V1rd19	A	C	7: 24,003,585	T159P	probably damaging	Het
Vars	T	C	17: 35,011,486	V515A	possibly damaging	Het
Vmn1r85	A	G	7: 13,084,588	Y210H	probably benign	Het
Vmn2r89	A	G	14: 51,455,978	T262A	probably damaging	Het
Vps53	G	A	11: 76,121,579	T209I	probably benign	Het
Wdfy2	T	C	14: 62,925,133	F95L	possibly damaging	Het
Wwp1	G	T	4: 19,627,911	S694Y	probably damaging	Het
Zbtb8b	T	A	4: 129,432,670	D201V	probably damaging	Het
Zmym5	A	C	14: 56,804,451	N123K	possibly damaging	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GATTTCCAGGCAGTCACTCACCTC -3'
(R):5'- GTGTTCAGAAAATTCCACCTGCACC -3'

Sequencing Primer
(F):5'- AGTCACTCACCTCAATTTGGAG -3'
(R):5'- CCATCCGCCGCTTTGAG -3'

Posted On

2013-04-24