Incidental Mutation 'R4111:Dip2c'
ID317326
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R4111 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9637101 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 1254 (G1254C)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably damaging
Transcript: ENSMUST00000166299
AA Change: G1255C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: G1255C

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169960
AA Change: G1225C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: G1225C

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174552
AA Change: G1254C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: G1254C

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000222280
AA Change: G357C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223052
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Ambra1 T C 2: 91,900,558 S894P probably damaging Het
Arhgef12 C A 9: 42,972,274 G1320C probably damaging Het
Atg7 G C 6: 114,713,294 G596R probably damaging Het
AY761184 T C 8: 21,702,663 T106A possibly damaging Het
Birc6 T C 17: 74,566,015 V423A probably damaging Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Ctu2 G A 8: 122,476,517 R24Q possibly damaging Het
Dclk3 T C 9: 111,469,080 I564T probably damaging Het
Ddx39b T A 17: 35,243,364 I42N possibly damaging Het
Dzip1 T A 14: 118,877,233 K837* probably null Het
Epha1 G A 6: 42,358,838 T955M possibly damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12355 A T 11: 98,625,397 V50D probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gpr37l1 T C 1: 135,167,270 T79A possibly damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Ifnar1 C A 16: 91,496,158 P230T probably damaging Het
Impact T C 18: 12,976,033 probably null Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Lrpprc G A 17: 84,726,338 T1037M probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr1440 T C 19: 12,394,301 F13L probably damaging Het
Olfr430 T A 1: 174,069,433 I45N probably damaging Het
Olfr979 C A 9: 40,000,898 E110* probably null Het
Pask A G 1: 93,310,818 V1315A probably damaging Het
Pramef25 T A 4: 143,949,905 I210F possibly damaging Het
Prl7a2 A T 13: 27,665,067 Y80N possibly damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rtn2 T C 7: 19,286,844 S81P probably damaging Het
Sbf2 G A 7: 110,428,242 P470S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sox30 A G 11: 46,017,214 Y736C probably benign Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Tns1 T C 1: 73,941,932 N1091S probably damaging Het
Trappc10 A G 10: 78,196,430 F1008S probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Uhrf1bp1 T A 17: 27,886,090 L586* probably null Het
Vmn1r122 A T 7: 21,133,513 S206T probably damaging Het
Vmn2r1 A C 3: 64,089,755 K277N probably benign Het
Vps13a T C 19: 16,640,628 E2931G probably damaging Het
Wdr70 G T 15: 7,976,991 Q360K probably benign Het
Wdr90 G T 17: 25,849,368 Q1329K possibly damaging Het
Wrn T C 8: 33,352,155 N37S probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp964 T A 8: 69,664,104 S450R probably benign Het
Zkscan2 T C 7: 123,482,684 probably benign Het
Zmynd10 A T 9: 107,549,052 K133* probably null Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
R7925:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7928:Dip2c UTSW 13 9609044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCTTCAGCTGACTGGC -3'
(R):5'- GAAACTTACCTGTAAGCAAATTGCC -3'

Sequencing Primer
(F):5'- CAGCTGACTGGCTTGGCTAG -3'
(R):5'- CCTGTAAGCAAATTGCCAGGTTC -3'
Posted On2015-05-15