Mutagenetix > Incidental Mutations

Incidental Mutation 'R4111:Dip2c'

317326

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.677) question?

Stock #

R4111 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 9637101 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 1254 (G1254C)

Ref Sequence

ENSEMBL: ENSMUSP00000133806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166299
AA Change: G1255C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: G1255C

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169960
AA Change: G1225C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: G1225C

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174552
AA Change: G1254C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: G1254C

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000222280
AA Change: G357C

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223052

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot10	A	T	15: 20,666,526	L43Q	probably damaging	Het
Alms1	G	A	6: 85,620,888	V1368I	probably benign	Het
Ambra1	T	C	2: 91,900,558	S894P	probably damaging	Het
Arhgef12	C	A	9: 42,972,274	G1320C	probably damaging	Het
Atg7	G	C	6: 114,713,294	G596R	probably damaging	Het
AY761184	T	C	8: 21,702,663	T106A	possibly damaging	Het
Birc6	T	C	17: 74,566,015	V423A	probably damaging	Het
Cdh17	T	C	4: 11,814,628	S728P	probably damaging	Het
Ctu2	G	A	8: 122,476,517	R24Q	possibly damaging	Het
Dclk3	T	C	9: 111,469,080	I564T	probably damaging	Het
Ddx39b	T	A	17: 35,243,364	I42N	possibly damaging	Het
Dzip1	T	A	14: 118,877,233	K837*	probably null	Het
Epha1	G	A	6: 42,358,838	T955M	possibly damaging	Het
Etfbkmt	T	C	6: 149,144,591		probably benign	Het
Etfrf1	T	C	6: 145,215,372	Y23H	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm12355	A	T	11: 98,625,397	V50D	probably damaging	Het
Gm5611	T	A	9: 17,030,693		noncoding transcript	Het
Gpr37l1	T	C	1: 135,167,270	T79A	possibly damaging	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Hyls1	T	A	9: 35,561,418	Y234F	probably damaging	Het
Ifnar1	C	A	16: 91,496,158	P230T	probably damaging	Het
Impact	T	C	18: 12,976,033		probably null	Het
Kcna6	G	C	6: 126,739,774	R51G	probably damaging	Het
Lrpprc	G	A	17: 84,726,338	T1037M	probably benign	Het
Olfr1239	C	A	2: 89,418,100	L104F	probably benign	Het
Olfr1440	T	C	19: 12,394,301	F13L	probably damaging	Het
Olfr430	T	A	1: 174,069,433	I45N	probably damaging	Het
Olfr979	C	A	9: 40,000,898	E110*	probably null	Het
Pask	A	G	1: 93,310,818	V1315A	probably damaging	Het
Pramef25	T	A	4: 143,949,905	I210F	possibly damaging	Het
Prl7a2	A	T	13: 27,665,067	Y80N	possibly damaging	Het
Rhox3f	G	T	X: 37,582,019	E140*	probably null	Het
Rtn2	T	C	7: 19,286,844	S81P	probably damaging	Het
Sbf2	G	A	7: 110,428,242	P470S	probably damaging	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Sox30	A	G	11: 46,017,214	Y736C	probably benign	Het
Synj2	G	A	17: 6,007,965	G243S	probably benign	Het
Tbr1	C	T	2: 61,811,732	P184L	probably benign	Het
Tns1	T	C	1: 73,941,932	N1091S	probably damaging	Het
Trappc10	A	G	10: 78,196,430	F1008S	probably benign	Het
Ube4a	T	A	9: 44,948,949	I272F	probably damaging	Het
Uhrf1bp1	T	A	17: 27,886,090	L586*	probably null	Het
Vmn1r122	A	T	7: 21,133,513	S206T	probably damaging	Het
Vmn2r1	A	C	3: 64,089,755	K277N	probably benign	Het
Vps13a	T	C	19: 16,640,628	E2931G	probably damaging	Het
Wdr70	G	T	15: 7,976,991	Q360K	probably benign	Het
Wdr90	G	T	17: 25,849,368	Q1329K	possibly damaging	Het
Wrn	T	C	8: 33,352,155	N37S	probably benign	Het
Yap1	A	T	9: 7,938,431	*358K	probably null	Het
Zfp964	T	A	8: 69,664,104	S450R	probably benign	Het
Zkscan2	T	C	7: 123,482,684		probably benign	Het
Zmynd10	A	T	9: 107,549,052	K133*	probably null	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R8354:Dip2c	UTSW	13	9621882	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGTTTCTTCAGCTGACTGGC -3'
(R):5'- GAAACTTACCTGTAAGCAAATTGCC -3'

Sequencing Primer
(F):5'- CAGCTGACTGGCTTGGCTAG -3'
(R):5'- CCTGTAAGCAAATTGCCAGGTTC -3'

Posted On

2015-05-15