Incidental Mutation 'R4111:Wdr70'
ID317329
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene NameWD repeat domain 70
Synonyms4833422F06Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4111 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location7873055-8099209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7976991 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 360 (Q360K)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766]
Predicted Effect probably benign
Transcript: ENSMUST00000045766
AA Change: Q360K

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: Q360K

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229131
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Ambra1 T C 2: 91,900,558 S894P probably damaging Het
Arhgef12 C A 9: 42,972,274 G1320C probably damaging Het
Atg7 G C 6: 114,713,294 G596R probably damaging Het
AY761184 T C 8: 21,702,663 T106A possibly damaging Het
Birc6 T C 17: 74,566,015 V423A probably damaging Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Ctu2 G A 8: 122,476,517 R24Q possibly damaging Het
Dclk3 T C 9: 111,469,080 I564T probably damaging Het
Ddx39b T A 17: 35,243,364 I42N possibly damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dzip1 T A 14: 118,877,233 K837* probably null Het
Epha1 G A 6: 42,358,838 T955M possibly damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12355 A T 11: 98,625,397 V50D probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gpr37l1 T C 1: 135,167,270 T79A possibly damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Ifnar1 C A 16: 91,496,158 P230T probably damaging Het
Impact T C 18: 12,976,033 probably null Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Lrpprc G A 17: 84,726,338 T1037M probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr1440 T C 19: 12,394,301 F13L probably damaging Het
Olfr430 T A 1: 174,069,433 I45N probably damaging Het
Olfr979 C A 9: 40,000,898 E110* probably null Het
Pask A G 1: 93,310,818 V1315A probably damaging Het
Pramef25 T A 4: 143,949,905 I210F possibly damaging Het
Prl7a2 A T 13: 27,665,067 Y80N possibly damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rtn2 T C 7: 19,286,844 S81P probably damaging Het
Sbf2 G A 7: 110,428,242 P470S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sox30 A G 11: 46,017,214 Y736C probably benign Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Tns1 T C 1: 73,941,932 N1091S probably damaging Het
Trappc10 A G 10: 78,196,430 F1008S probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Uhrf1bp1 T A 17: 27,886,090 L586* probably null Het
Vmn1r122 A T 7: 21,133,513 S206T probably damaging Het
Vmn2r1 A C 3: 64,089,755 K277N probably benign Het
Vps13a T C 19: 16,640,628 E2931G probably damaging Het
Wdr90 G T 17: 25,849,368 Q1329K possibly damaging Het
Wrn T C 8: 33,352,155 N37S probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp964 T A 8: 69,664,104 S450R probably benign Het
Zkscan2 T C 7: 123,482,684 probably benign Het
Zmynd10 A T 9: 107,549,052 K133* probably null Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8019607 missense probably benign 0.07
IGL01121:Wdr70 APN 15 7873174 missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8079263 missense probably benign 0.33
IGL01801:Wdr70 APN 15 7887324 splice site probably null
IGL01815:Wdr70 APN 15 7887324 splice site probably null
IGL01929:Wdr70 APN 15 7920634 splice site probably null
IGL02150:Wdr70 APN 15 8082546 missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8046482 missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7884302 nonsense probably null
IGL02800:Wdr70 APN 15 8082496 missense probably benign 0.25
IGL02829:Wdr70 APN 15 7976982 missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7884306 missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7884340 missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8035871 missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0462:Wdr70 UTSW 15 8079161 missense probably benign 0.00
R0539:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8035844 missense probably benign 0.01
R1812:Wdr70 UTSW 15 8079179 missense probably benign 0.00
R1863:Wdr70 UTSW 15 7920573 missense probably benign 0.25
R1913:Wdr70 UTSW 15 7884410 missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7887359 nonsense probably null
R4013:Wdr70 UTSW 15 8079214 nonsense probably null
R4015:Wdr70 UTSW 15 8079214 nonsense probably null
R4017:Wdr70 UTSW 15 8079214 nonsense probably null
R5241:Wdr70 UTSW 15 8079216 missense probably benign
R5277:Wdr70 UTSW 15 7976984 nonsense probably null
R5306:Wdr70 UTSW 15 7924273 missense probably benign 0.04
R5426:Wdr70 UTSW 15 7922105 missense possibly damaging 0.59
R5586:Wdr70 UTSW 15 7884288 missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7887419 splice site probably null
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8079154 splice site probably null
R6139:Wdr70 UTSW 15 8079251 missense probably benign 0.04
R6400:Wdr70 UTSW 15 8042841 missense probably benign 0.32
R6456:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R6518:Wdr70 UTSW 15 8079337 missense unknown
R7036:Wdr70 UTSW 15 7884374 missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7884396 missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7924244 missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7922081 missense probably benign 0.23
R7572:Wdr70 UTSW 15 8035846 missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8079216 missense probably benign
R7886:Wdr70 UTSW 15 8079249 missense probably benign 0.02
R8103:Wdr70 UTSW 15 7977131 missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7887370 missense probably benign 0.03
R8252:Wdr70 UTSW 15 8042856 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCTGTTCTTTGCAGAAAG -3'
(R):5'- ATTTATGGGCCTGCTTCTTCAG -3'

Sequencing Primer
(F):5'- TCTGGACATGATGATACACACC -3'
(R):5'- AAACCTCGGACAATGCAG -3'
Posted On2015-05-15