Incidental Mutation 'R4111:Acot10'
ID 317330
Institutional Source Beutler Lab
Gene Symbol Acot10
Ensembl Gene ENSMUSG00000047565
Gene Name acyl-CoA thioesterase 10
Synonyms MT-ACT48, p48, Acate3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R4111 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 20665214-20666750 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20666526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 43 (L43Q)
Ref Sequence ENSEMBL: ENSMUSP00000051333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052910]
AlphaFold Q32MW3
Predicted Effect probably damaging
Transcript: ENSMUST00000052910
AA Change: L43Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051333
Gene: ENSMUSG00000047565
AA Change: L43Q

DomainStartEndE-ValueType
SCOP:d1lo7a_ 108 222 1e-4 SMART
PDB:4IEN|D 277 400 3e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228652
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Ambra1 T C 2: 91,900,558 S894P probably damaging Het
Arhgef12 C A 9: 42,972,274 G1320C probably damaging Het
Atg7 G C 6: 114,713,294 G596R probably damaging Het
AY761184 T C 8: 21,702,663 T106A possibly damaging Het
Birc6 T C 17: 74,566,015 V423A probably damaging Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Ctu2 G A 8: 122,476,517 R24Q possibly damaging Het
Dclk3 T C 9: 111,469,080 I564T probably damaging Het
Ddx39b T A 17: 35,243,364 I42N possibly damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dzip1 T A 14: 118,877,233 K837* probably null Het
Epha1 G A 6: 42,358,838 T955M possibly damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12355 A T 11: 98,625,397 V50D probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gpr37l1 T C 1: 135,167,270 T79A possibly damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Ifnar1 C A 16: 91,496,158 P230T probably damaging Het
Impact T C 18: 12,976,033 probably null Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Lrpprc G A 17: 84,726,338 T1037M probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr1440 T C 19: 12,394,301 F13L probably damaging Het
Olfr430 T A 1: 174,069,433 I45N probably damaging Het
Olfr979 C A 9: 40,000,898 E110* probably null Het
Pask A G 1: 93,310,818 V1315A probably damaging Het
Pramef25 T A 4: 143,949,905 I210F possibly damaging Het
Prl7a2 A T 13: 27,665,067 Y80N possibly damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rtn2 T C 7: 19,286,844 S81P probably damaging Het
Sbf2 G A 7: 110,428,242 P470S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sox30 A G 11: 46,017,214 Y736C probably benign Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Tns1 T C 1: 73,941,932 N1091S probably damaging Het
Trappc10 A G 10: 78,196,430 F1008S probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Uhrf1bp1 T A 17: 27,886,090 L586* probably null Het
Vmn1r122 A T 7: 21,133,513 S206T probably damaging Het
Vmn2r1 A C 3: 64,089,755 K277N probably benign Het
Vps13a T C 19: 16,640,628 E2931G probably damaging Het
Wdr70 G T 15: 7,976,991 Q360K probably benign Het
Wdr90 G T 17: 25,849,368 Q1329K possibly damaging Het
Wrn T C 8: 33,352,155 N37S probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp964 T A 8: 69,664,104 S450R probably benign Het
Zkscan2 T C 7: 123,482,684 probably benign Het
Zmynd10 A T 9: 107,549,052 K133* probably null Het
Other mutations in Acot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Acot10 APN 15 20665965 missense probably benign 0.11
IGL01610:Acot10 APN 15 20665695 missense probably damaging 1.00
IGL02457:Acot10 APN 15 20666143 missense possibly damaging 0.88
IGL02587:Acot10 APN 15 20665797 missense possibly damaging 0.93
IGL02951:Acot10 APN 15 20665782 missense probably benign 0.36
ANU23:Acot10 UTSW 15 20665965 missense probably benign 0.11
PIT4151001:Acot10 UTSW 15 20666598 missense probably damaging 0.98
R0026:Acot10 UTSW 15 20666236 missense probably benign 0.10
R0026:Acot10 UTSW 15 20666236 missense probably benign 0.10
R0462:Acot10 UTSW 15 20666626 missense possibly damaging 0.85
R1312:Acot10 UTSW 15 20666499 missense probably benign 0.00
R1495:Acot10 UTSW 15 20665507 missense probably damaging 0.99
R2128:Acot10 UTSW 15 20666626 missense probably benign 0.00
R3779:Acot10 UTSW 15 20665542 missense probably damaging 0.98
R4110:Acot10 UTSW 15 20666526 missense probably damaging 1.00
R4464:Acot10 UTSW 15 20665744 nonsense probably null
R4668:Acot10 UTSW 15 20665942 missense probably benign
R4933:Acot10 UTSW 15 20666330 missense possibly damaging 0.88
R5255:Acot10 UTSW 15 20665932 missense probably benign 0.01
R5885:Acot10 UTSW 15 20666104 missense probably benign 0.01
R6190:Acot10 UTSW 15 20665785 missense possibly damaging 0.80
R6301:Acot10 UTSW 15 20666262 missense probably benign 0.05
R6805:Acot10 UTSW 15 20665366 missense probably benign 0.42
R7334:Acot10 UTSW 15 20665543 missense possibly damaging 0.86
R7601:Acot10 UTSW 15 20665629 missense probably damaging 1.00
R8400:Acot10 UTSW 15 20666172 missense possibly damaging 0.56
R9195:Acot10 UTSW 15 20665431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTCCTCAAGAATCCTGC -3'
(R):5'- TTCTCTACCTGGGAGGACCTTG -3'

Sequencing Primer
(F):5'- CACATATTTGTCTCGTAGTTCAGG -3'
(R):5'- GACCTTGGTTGTCCACCCG -3'
Posted On 2015-05-15