Incidental Mutation 'R4086:Phlpp1'
ID 317345
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene Name PH domain and leucine rich repeat protein phosphatase 1
Synonyms Phlpp, Plekhe1
MMRRC Submission 041625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R4086 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 106171752-106394250 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106347161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 885 (I885V)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
AlphaFold Q8CHE4
Predicted Effect probably benign
Transcript: ENSMUST00000061047
AA Change: I885V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: I885V

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Meta Mutation Damage Score 0.0640 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd7 G A 2: 3,340,451 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Adcy7 A G 8: 88,315,786 D427G probably benign Het
Adrm1 A G 2: 180,172,834 probably benign Het
Arfgef1 T C 1: 10,163,759 I1103M probably benign Het
Arhgap32 A C 9: 32,247,066 probably benign Het
Arhgef28 T C 13: 97,967,204 R767G probably damaging Het
BC046251 A G 7: 65,582,148 noncoding transcript Het
Brwd1 T C 16: 96,046,372 S683G probably benign Het
Calcoco1 C G 15: 102,710,399 probably benign Het
Carmil1 G T 13: 24,024,461 P834T possibly damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col24a1 G A 3: 145,461,437 G1090R probably damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Ets2 C A 16: 95,709,789 D30E probably damaging Het
Fam181b T C 7: 93,080,580 V187A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo41 C T 6: 85,478,546 R552Q possibly damaging Het
Fstl5 G T 3: 76,648,286 C53F probably damaging Het
Ftsj3 T C 11: 106,249,569 Y791C probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 A G 5: 109,943,255 K458E probably benign Het
Hecw2 T C 1: 53,831,656 I1389V probably damaging Het
Ipo9 A G 1: 135,388,690 probably benign Het
Krtap31-1 C T 11: 99,908,319 T116I possibly damaging Het
Mafa T G 15: 75,747,137 K262N probably damaging Het
Nxph4 T C 10: 127,526,686 Y112C probably damaging Het
Olfr814 A G 10: 129,874,298 V153A possibly damaging Het
Olfr987 C A 2: 85,331,826 W24L probably benign Het
Pgls G A 8: 71,596,090 A142T probably damaging Het
Prkcq A G 2: 11,283,868 D544G probably damaging Het
Rnf44 T C 13: 54,682,335 N254D possibly damaging Het
Sept10 A T 10: 59,192,223 L92* probably null Het
Slc14a2 A T 18: 78,205,783 I156N probably damaging Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Thap12 A G 7: 98,716,494 D623G possibly damaging Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ube2u T A 4: 100,549,842 I187N probably benign Het
Vmn1r90 G A 7: 14,563,294 probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xpo4 C T 14: 57,643,033 probably benign Het
Zbtb21 A T 16: 97,952,763 Y135N probably damaging Het
Zbtb22 T A 17: 33,918,168 V429D probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zhx1 T C 15: 58,052,921 E643G possibly damaging Het
Zzef1 C T 11: 72,875,053 H1469Y probably benign Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106376255 missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106339448 missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106173436 missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106380389 missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106389883 missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106392714 missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106376297 splice site probably null
IGL03178:Phlpp1 APN 1 106392388 missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106392934 missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106339615 missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106350578 missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106392283 missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106389665 splice site probably null
R1394:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106380425 splice site probably null
R1438:Phlpp1 UTSW 1 106173412 missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106392319 missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106392789 missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106380385 missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106343505 missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106318850 missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106172839 missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106172772 missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106393191 small deletion probably benign
R3832:Phlpp1 UTSW 1 106392597 missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106392549 missense probably damaging 0.98
R4112:Phlpp1 UTSW 1 106364338 missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106386446 missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106339501 missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106389751 missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106281471 missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106173394 missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106172725 missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106364390 missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106173432 missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106392927 missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106347132 nonsense probably null
R5955:Phlpp1 UTSW 1 106364230 splice site probably null
R5992:Phlpp1 UTSW 1 106318993 nonsense probably null
R6469:Phlpp1 UTSW 1 106287103 missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106386444 missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106172479 missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106172667 missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106389690 missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106392573 missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106281402 missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
R7970:Phlpp1 UTSW 1 106173285 missense probably damaging 1.00
R8080:Phlpp1 UTSW 1 106392976 missense probably benign 0.00
R8133:Phlpp1 UTSW 1 106172792 frame shift probably null
R8224:Phlpp1 UTSW 1 106392618 missense probably damaging 1.00
R8503:Phlpp1 UTSW 1 106392289 missense probably benign 0.00
R8830:Phlpp1 UTSW 1 106350603 missense probably damaging 1.00
R8882:Phlpp1 UTSW 1 106392642 missense probably benign 0.01
R9257:Phlpp1 UTSW 1 106172551 missense possibly damaging 0.85
R9472:Phlpp1 UTSW 1 106380349 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGGCTCATTGTAGTTTGGC -3'
(R):5'- ACCTGAAAAGTCTCCATCCTATG -3'

Sequencing Primer
(F):5'- CCCAGTGTGTACCTGCATGAATG -3'
(R):5'- TGATGATACATGAATAAAAAGCAACG -3'
Posted On 2015-05-15