Incidental Mutation 'R4086:Traf3ip3'
ID317348
Institutional Source Beutler Lab
Gene Symbol Traf3ip3
Ensembl Gene ENSMUSG00000037318
Gene NameTRAF3 interacting protein 3
Synonyms6030423D04Rik
MMRRC Submission 041625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4086 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location193175453-193201703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 193181320 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 414 (V414A)
Ref Sequence ENSEMBL: ENSMUSP00000141698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043550] [ENSMUST00000159666] [ENSMUST00000160822] [ENSMUST00000178744] [ENSMUST00000192020] [ENSMUST00000194278]
Predicted Effect probably damaging
Transcript: ENSMUST00000043550
AA Change: V414A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040977
Gene: ENSMUSG00000037318
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159666
Predicted Effect unknown
Transcript: ENSMUST00000160302
AA Change: V116A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160332
Predicted Effect probably benign
Transcript: ENSMUST00000160822
SMART Domains Protein: ENSMUSP00000124546
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 15 263 2.7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161403
Predicted Effect probably benign
Transcript: ENSMUST00000162480
Predicted Effect probably benign
Transcript: ENSMUST00000178744
SMART Domains Protein: ENSMUSP00000136653
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192020
AA Change: V414A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141698
Gene: ENSMUSG00000037318
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194278
SMART Domains Protein: ENSMUSP00000141661
Gene: ENSMUSG00000037318

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Meta Mutation Damage Score 0.0970 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that mediates cell growth by modulating the c-Jun N-terminal kinase signal transduction pathway. The encoded protein may also interact with a large multi-protein assembly containing the phosphatase 2A catalytic subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired single positive thymocyte development and increased gamma-delta T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd7 G A 2: 3,340,451 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Adcy7 A G 8: 88,315,786 D427G probably benign Het
Adrm1 A G 2: 180,172,834 probably benign Het
Arfgef1 T C 1: 10,163,759 I1103M probably benign Het
Arhgap32 A C 9: 32,247,066 probably benign Het
Arhgef28 T C 13: 97,967,204 R767G probably damaging Het
BC046251 A G 7: 65,582,148 noncoding transcript Het
Brwd1 T C 16: 96,046,372 S683G probably benign Het
Calcoco1 C G 15: 102,710,399 probably benign Het
Carmil1 G T 13: 24,024,461 P834T possibly damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col24a1 G A 3: 145,461,437 G1090R probably damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Ets2 C A 16: 95,709,789 D30E probably damaging Het
Fam181b T C 7: 93,080,580 V187A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo41 C T 6: 85,478,546 R552Q possibly damaging Het
Fstl5 G T 3: 76,648,286 C53F probably damaging Het
Ftsj3 T C 11: 106,249,569 Y791C probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 A G 5: 109,943,255 K458E probably benign Het
Hecw2 T C 1: 53,831,656 I1389V probably damaging Het
Ipo9 A G 1: 135,388,690 probably benign Het
Krtap31-1 C T 11: 99,908,319 T116I possibly damaging Het
Mafa T G 15: 75,747,137 K262N probably damaging Het
Nxph4 T C 10: 127,526,686 Y112C probably damaging Het
Olfr814 A G 10: 129,874,298 V153A possibly damaging Het
Olfr987 C A 2: 85,331,826 W24L probably benign Het
Pgls G A 8: 71,596,090 A142T probably damaging Het
Phlpp1 A G 1: 106,347,161 I885V probably benign Het
Prkcq A G 2: 11,283,868 D544G probably damaging Het
Rnf44 T C 13: 54,682,335 N254D possibly damaging Het
Sept10 A T 10: 59,192,223 L92* probably null Het
Slc14a2 A T 18: 78,205,783 I156N probably damaging Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Thap12 A G 7: 98,716,494 D623G possibly damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ube2u T A 4: 100,549,842 I187N probably benign Het
Vmn1r90 G A 7: 14,563,294 probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xpo4 C T 14: 57,643,033 probably benign Het
Zbtb21 A T 16: 97,952,763 Y135N probably damaging Het
Zbtb22 T A 17: 33,918,168 V429D probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zhx1 T C 15: 58,052,921 E643G possibly damaging Het
Zzef1 C T 11: 72,875,053 H1469Y probably benign Het
Other mutations in Traf3ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Traf3ip3 APN 1 193194820 intron probably benign
IGL00663:Traf3ip3 APN 1 193187138 missense probably damaging 1.00
IGL01125:Traf3ip3 APN 1 193184464 splice site probably null
IGL01308:Traf3ip3 APN 1 193184891 missense probably damaging 1.00
IGL01608:Traf3ip3 APN 1 193187110 missense probably benign 0.00
IGL02225:Traf3ip3 APN 1 193195100 missense probably benign 0.03
IGL02432:Traf3ip3 APN 1 193184576 missense probably damaging 1.00
IGL03102:Traf3ip3 APN 1 193195077 missense probably damaging 1.00
IGL03179:Traf3ip3 APN 1 193194368 missense probably damaging 1.00
IGL02988:Traf3ip3 UTSW 1 193194874 unclassified probably null
R0110:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0469:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0510:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0529:Traf3ip3 UTSW 1 193194811 intron probably benign
R1165:Traf3ip3 UTSW 1 193184478 missense probably damaging 0.99
R1559:Traf3ip3 UTSW 1 193178291 missense probably damaging 0.99
R1729:Traf3ip3 UTSW 1 193181893 missense probably benign 0.01
R1896:Traf3ip3 UTSW 1 193175734 missense probably benign
R4085:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4087:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4088:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4090:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4258:Traf3ip3 UTSW 1 193197946 missense probably damaging 1.00
R4817:Traf3ip3 UTSW 1 193184829 missense probably damaging 1.00
R5299:Traf3ip3 UTSW 1 193178175 nonsense probably null
R5906:Traf3ip3 UTSW 1 193198006 missense possibly damaging 0.55
R6268:Traf3ip3 UTSW 1 193198036 start gained probably benign
R6374:Traf3ip3 UTSW 1 193182010 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTTGTGCAGATGATCCCTCAGC -3'
(R):5'- TGAAAGGACCCACTAGTGTGTG -3'

Sequencing Primer
(F):5'- GATGATCCCTCAGCCCAGC -3'
(R):5'- CCTGTGTGAATGCTGGCCTC -3'
Posted On2015-05-15