Mutagenetix > Incidental Mutation

Incidental Mutation 'R4086:Col24a1'

317355

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

041625-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4086 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 145461437 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 1090 (G1090R)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably damaging
Transcript: ENSMUST00000029848
AA Change: G1090R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: G1090R

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Meta Mutation Damage Score

0.9163

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd7	G	A	2: 3,340,451		probably null	Het
Acss3	T	G	10: 107,053,452	Y169S	probably damaging	Het
Adcy7	A	G	8: 88,315,786	D427G	probably benign	Het
Adrm1	A	G	2: 180,172,834		probably benign	Het
Arfgef1	T	C	1: 10,163,759	I1103M	probably benign	Het
Arhgap32	A	C	9: 32,247,066		probably benign	Het
Arhgef28	T	C	13: 97,967,204	R767G	probably damaging	Het
BC046251	A	G	7: 65,582,148		noncoding transcript	Het
Brwd1	T	C	16: 96,046,372	S683G	probably benign	Het
Calcoco1	C	G	15: 102,710,399		probably benign	Het
Carmil1	G	T	13: 24,024,461	P834T	possibly damaging	Het
Cldn34c4	A	T	X: 127,721,388	V153E	probably damaging	Het
Csmd1	T	A	8: 15,992,738	I2332F	probably damaging	Het
Ets2	C	A	16: 95,709,789	D30E	probably damaging	Het
Fam181b	T	C	7: 93,080,580	V187A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fbxo41	C	T	6: 85,478,546	R552Q	possibly damaging	Het
Fstl5	G	T	3: 76,648,286	C53F	probably damaging	Het
Ftsj3	T	C	11: 106,249,569	Y791C	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm15446	A	G	5: 109,943,255	K458E	probably benign	Het
Hecw2	T	C	1: 53,831,656	I1389V	probably damaging	Het
Ipo9	A	G	1: 135,388,690		probably benign	Het
Krtap31-1	C	T	11: 99,908,319	T116I	possibly damaging	Het
Mafa	T	G	15: 75,747,137	K262N	probably damaging	Het
Nxph4	T	C	10: 127,526,686	Y112C	probably damaging	Het
Olfr814	A	G	10: 129,874,298	V153A	possibly damaging	Het
Olfr987	C	A	2: 85,331,826	W24L	probably benign	Het
Pgls	G	A	8: 71,596,090	A142T	probably damaging	Het
Phlpp1	A	G	1: 106,347,161	I885V	probably benign	Het
Prkcq	A	G	2: 11,283,868	D544G	probably damaging	Het
Rnf44	T	C	13: 54,682,335	N254D	possibly damaging	Het
Sept10	A	T	10: 59,192,223	L92*	probably null	Het
Slc14a2	A	T	18: 78,205,783	I156N	probably damaging	Het
Sos1	A	G	17: 80,449,352	V257A	probably benign	Het
Sypl2	A	G	3: 108,217,676	I123T	possibly damaging	Het
Thap12	A	G	7: 98,716,494	D623G	possibly damaging	Het
Traf3ip3	A	G	1: 193,181,320	V414A	probably damaging	Het
Trim14	T	A	4: 46,523,709	T110S	probably benign	Het
Trim30d	T	C	7: 104,487,800	N66D	probably damaging	Het
Trim65	G	A	11: 116,126,479	Q386*	probably null	Het
Ube2u	T	A	4: 100,549,842	I187N	probably benign	Het
Vmn1r90	G	A	7: 14,563,294		probably benign	Het
Wbp2nl	A	G	15: 82,308,561	M149V	probably benign	Het
Xpo4	C	T	14: 57,643,033		probably benign	Het
Zbtb21	A	T	16: 97,952,763	Y135N	probably damaging	Het
Zbtb22	T	A	17: 33,918,168	V429D	probably damaging	Het
Zfp281	T	A	1: 136,626,121	I279N	probably damaging	Het
Zhx1	T	C	15: 58,052,921	E643G	possibly damaging	Het
Zzef1	C	T	11: 72,875,053	H1469Y	probably benign	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATCCTGAGAATGACTGACACTTTG -3'
(R):5'- TGTCAGTGTCTGTGCCCATG -3'

Sequencing Primer
(F):5'- AACTCACTTTGTAGGCCAGG -3'
(R):5'- CCATGCCTGCCTTGTGTGTG -3'

Posted On

2015-05-15