Incidental Mutation 'R4086:Arhgap32'
ID317372
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 041625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4086 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 32247066 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802] [ENSMUST00000183121]
Predicted Effect probably benign
Transcript: ENSMUST00000168954
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174641
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174730
Predicted Effect probably benign
Transcript: ENSMUST00000182802
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183121
SMART Domains Protein: ENSMUSP00000138584
Gene: ENSMUSG00000041444

DomainStartEndE-ValueType
Pfam:RhoGAP 37 92 5.9e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd7 G A 2: 3,340,451 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Adcy7 A G 8: 88,315,786 D427G probably benign Het
Adrm1 A G 2: 180,172,834 probably benign Het
Arfgef1 T C 1: 10,163,759 I1103M probably benign Het
Arhgef28 T C 13: 97,967,204 R767G probably damaging Het
BC046251 A G 7: 65,582,148 noncoding transcript Het
Brwd1 T C 16: 96,046,372 S683G probably benign Het
Calcoco1 C G 15: 102,710,399 probably benign Het
Carmil1 G T 13: 24,024,461 P834T possibly damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col24a1 G A 3: 145,461,437 G1090R probably damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Ets2 C A 16: 95,709,789 D30E probably damaging Het
Fam181b T C 7: 93,080,580 V187A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo41 C T 6: 85,478,546 R552Q possibly damaging Het
Fstl5 G T 3: 76,648,286 C53F probably damaging Het
Ftsj3 T C 11: 106,249,569 Y791C probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 A G 5: 109,943,255 K458E probably benign Het
Hecw2 T C 1: 53,831,656 I1389V probably damaging Het
Ipo9 A G 1: 135,388,690 probably benign Het
Krtap31-1 C T 11: 99,908,319 T116I possibly damaging Het
Mafa T G 15: 75,747,137 K262N probably damaging Het
Nxph4 T C 10: 127,526,686 Y112C probably damaging Het
Olfr814 A G 10: 129,874,298 V153A possibly damaging Het
Olfr987 C A 2: 85,331,826 W24L probably benign Het
Pgls G A 8: 71,596,090 A142T probably damaging Het
Phlpp1 A G 1: 106,347,161 I885V probably benign Het
Prkcq A G 2: 11,283,868 D544G probably damaging Het
Rnf44 T C 13: 54,682,335 N254D possibly damaging Het
Sept10 A T 10: 59,192,223 L92* probably null Het
Slc14a2 A T 18: 78,205,783 I156N probably damaging Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Thap12 A G 7: 98,716,494 D623G possibly damaging Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ube2u T A 4: 100,549,842 I187N probably benign Het
Vmn1r90 G A 7: 14,563,294 probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xpo4 C T 14: 57,643,033 probably benign Het
Zbtb21 A T 16: 97,952,763 Y135N probably damaging Het
Zbtb22 T A 17: 33,918,168 V429D probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zhx1 T C 15: 58,052,921 E643G possibly damaging Het
Zzef1 C T 11: 72,875,053 H1469Y probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
R7391:Arhgap32 UTSW 9 32181939 missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32245924 missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32250722 missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32256967 missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32257145 missense probably benign
R7884:Arhgap32 UTSW 9 32260514 missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32257028 missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32181854 missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32247130 missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32181900 missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32256902 missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32260909 missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32255937 nonsense probably null
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32260680 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGCTTTTCACTATGAAAGCAG -3'
(R):5'- CCTAGATGGCTGCTTTAGGG -3'

Sequencing Primer
(F):5'- TCACTATGAAAGCAGATCAGCTG -3'
(R):5'- TCTTGATGAAAAATGATGCAAGGC -3'
Posted On2015-05-15