Incidental Mutation 'R4086:Xpo4'
ID 317385
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Name exportin 4
Synonyms
MMRRC Submission 041625-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock # R4086 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 57577521-57665430 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to T at 57643033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000172524] [ENSMUST00000174152] [ENSMUST00000174545] [ENSMUST00000174694]
AlphaFold Q9ESJ0
Predicted Effect probably benign
Transcript: ENSMUST00000089482
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173940
Predicted Effect probably benign
Transcript: ENSMUST00000174152
Predicted Effect probably benign
Transcript: ENSMUST00000174545
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174694
SMART Domains Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942

DomainStartEndE-ValueType
PDB:2COS|A 91 138 7e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
Pfam:Pkinase 626 792 2.2e-38 PFAM
Pfam:Pkinase_Tyr 626 795 2.8e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd7 G A 2: 3,340,451 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Adcy7 A G 8: 88,315,786 D427G probably benign Het
Adrm1 A G 2: 180,172,834 probably benign Het
Arfgef1 T C 1: 10,163,759 I1103M probably benign Het
Arhgap32 A C 9: 32,247,066 probably benign Het
Arhgef28 T C 13: 97,967,204 R767G probably damaging Het
BC046251 A G 7: 65,582,148 noncoding transcript Het
Brwd1 T C 16: 96,046,372 S683G probably benign Het
Calcoco1 C G 15: 102,710,399 probably benign Het
Carmil1 G T 13: 24,024,461 P834T possibly damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col24a1 G A 3: 145,461,437 G1090R probably damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Ets2 C A 16: 95,709,789 D30E probably damaging Het
Fam181b T C 7: 93,080,580 V187A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo41 C T 6: 85,478,546 R552Q possibly damaging Het
Fstl5 G T 3: 76,648,286 C53F probably damaging Het
Ftsj3 T C 11: 106,249,569 Y791C probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 A G 5: 109,943,255 K458E probably benign Het
Hecw2 T C 1: 53,831,656 I1389V probably damaging Het
Ipo9 A G 1: 135,388,690 probably benign Het
Krtap31-1 C T 11: 99,908,319 T116I possibly damaging Het
Mafa T G 15: 75,747,137 K262N probably damaging Het
Nxph4 T C 10: 127,526,686 Y112C probably damaging Het
Olfr814 A G 10: 129,874,298 V153A possibly damaging Het
Olfr987 C A 2: 85,331,826 W24L probably benign Het
Pgls G A 8: 71,596,090 A142T probably damaging Het
Phlpp1 A G 1: 106,347,161 I885V probably benign Het
Prkcq A G 2: 11,283,868 D544G probably damaging Het
Rnf44 T C 13: 54,682,335 N254D possibly damaging Het
Sept10 A T 10: 59,192,223 L92* probably null Het
Slc14a2 A T 18: 78,205,783 I156N probably damaging Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Thap12 A G 7: 98,716,494 D623G possibly damaging Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ube2u T A 4: 100,549,842 I187N probably benign Het
Vmn1r90 G A 7: 14,563,294 probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zbtb21 A T 16: 97,952,763 Y135N probably damaging Het
Zbtb22 T A 17: 33,918,168 V429D probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zhx1 T C 15: 58,052,921 E643G possibly damaging Het
Zzef1 C T 11: 72,875,053 H1469Y probably benign Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57604398 missense probably benign
IGL02537:Xpo4 APN 14 57593833 missense probably benign
IGL02554:Xpo4 APN 14 57590088 missense probably benign 0.00
IGL02826:Xpo4 APN 14 57629420 missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57618228 missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57584611 missense probably null 0.98
R0245:Xpo4 UTSW 14 57630240 missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57613274 missense probably benign 0.07
R0606:Xpo4 UTSW 14 57638208 unclassified probably benign
R0761:Xpo4 UTSW 14 57613383 missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57603672 missense probably benign
R1853:Xpo4 UTSW 14 57585907 missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57590871 missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57586644 missense probably null 0.19
R2035:Xpo4 UTSW 14 57585926 missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57590090 missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57629503 missense probably benign 0.00
R2937:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R2938:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R4066:Xpo4 UTSW 14 57588054 missense probably benign 0.07
R4373:Xpo4 UTSW 14 57591022 nonsense probably null
R4620:Xpo4 UTSW 14 57630325 missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57590108 missense probably benign 0.01
R4755:Xpo4 UTSW 14 57618181 missense probably benign 0.01
R4831:Xpo4 UTSW 14 57590102 missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57638289 missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57638240 missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57584641 missense probably benign 0.02
R5279:Xpo4 UTSW 14 57613409 missense probably benign 0.37
R5375:Xpo4 UTSW 14 57638307 missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57590989 missense probably benign 0.03
R5936:Xpo4 UTSW 14 57643499 missense probably benign
R6393:Xpo4 UTSW 14 57638313 missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57613403 missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57582310 missense probably benign
R6923:Xpo4 UTSW 14 57603711 missense probably benign 0.19
R7028:Xpo4 UTSW 14 57597051 missense probably benign 0.22
R7442:Xpo4 UTSW 14 57630223 missense probably benign 0.00
R7469:Xpo4 UTSW 14 57597979 missense probably benign
R7490:Xpo4 UTSW 14 57602621 frame shift probably null
R7622:Xpo4 UTSW 14 57597011 missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57589959 missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57613349 missense probably benign 0.00
R7895:Xpo4 UTSW 14 57602591 missense probably benign 0.03
R8000:Xpo4 UTSW 14 57589946 missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57597884 critical splice donor site probably null
R8395:Xpo4 UTSW 14 57648467 missense probably benign 0.01
R8420:Xpo4 UTSW 14 57604456 missense probably damaging 0.99
R8836:Xpo4 UTSW 14 57664910 missense probably benign 0.03
R8841:Xpo4 UTSW 14 57597956 missense probably damaging 0.97
R8989:Xpo4 UTSW 14 57591018 missense probably benign 0.00
R9229:Xpo4 UTSW 14 57613699 missense probably benign
R9374:Xpo4 UTSW 14 57591055 missense possibly damaging 0.94
R9551:Xpo4 UTSW 14 57591055 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATCTTATAATACTCAGCCCATGC -3'
(R):5'- TCCCCAGAAACCAGTAAAGTGG -3'

Sequencing Primer
(F):5'- GCAAGAAAATGTAAGTTTTGACAGTC -3'
(R):5'- CAGAAACCAGTAAAGTGGACTATGTC -3'
Posted On 2015-05-15