Incidental Mutation 'R4086:Wbp2nl'
ID317388
Institutional Source Beutler Lab
Gene Symbol Wbp2nl
Ensembl Gene ENSMUSG00000022455
Gene NameWBP2 N-terminal like
Synonyms4930521I23Rik, PAWP
MMRRC Submission 041625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4086 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82298954-82314623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82308561 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 149 (M149V)
Ref Sequence ENSEMBL: ENSMUSP00000023089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023089]
Predicted Effect probably benign
Transcript: ENSMUST00000023089
AA Change: M149V

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023089
Gene: ENSMUSG00000022455
AA Change: M149V

DomainStartEndE-ValueType
Pfam:GRAM 4 87 1e-9 PFAM
Pfam:WWbp 103 226 2e-23 PFAM
low complexity region 238 262 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WBP2NL is a sperm-specific WW domain-binding protein that promotes meiotic resumption and pronuclear development during oocyte fertilization (Wu et al., 2007 [PubMed 17289678]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit normal sperm morphology, acrosomal reaction, egg activation and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd7 G A 2: 3,340,451 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Adcy7 A G 8: 88,315,786 D427G probably benign Het
Adrm1 A G 2: 180,172,834 probably benign Het
Arfgef1 T C 1: 10,163,759 I1103M probably benign Het
Arhgap32 A C 9: 32,247,066 probably benign Het
Arhgef28 T C 13: 97,967,204 R767G probably damaging Het
BC046251 A G 7: 65,582,148 noncoding transcript Het
Brwd1 T C 16: 96,046,372 S683G probably benign Het
Calcoco1 C G 15: 102,710,399 probably benign Het
Carmil1 G T 13: 24,024,461 P834T possibly damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col24a1 G A 3: 145,461,437 G1090R probably damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Ets2 C A 16: 95,709,789 D30E probably damaging Het
Fam181b T C 7: 93,080,580 V187A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo41 C T 6: 85,478,546 R552Q possibly damaging Het
Fstl5 G T 3: 76,648,286 C53F probably damaging Het
Ftsj3 T C 11: 106,249,569 Y791C probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 A G 5: 109,943,255 K458E probably benign Het
Hecw2 T C 1: 53,831,656 I1389V probably damaging Het
Ipo9 A G 1: 135,388,690 probably benign Het
Krtap31-1 C T 11: 99,908,319 T116I possibly damaging Het
Mafa T G 15: 75,747,137 K262N probably damaging Het
Nxph4 T C 10: 127,526,686 Y112C probably damaging Het
Olfr814 A G 10: 129,874,298 V153A possibly damaging Het
Olfr987 C A 2: 85,331,826 W24L probably benign Het
Pgls G A 8: 71,596,090 A142T probably damaging Het
Phlpp1 A G 1: 106,347,161 I885V probably benign Het
Prkcq A G 2: 11,283,868 D544G probably damaging Het
Rnf44 T C 13: 54,682,335 N254D possibly damaging Het
Sept10 A T 10: 59,192,223 L92* probably null Het
Slc14a2 A T 18: 78,205,783 I156N probably damaging Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Thap12 A G 7: 98,716,494 D623G possibly damaging Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ube2u T A 4: 100,549,842 I187N probably benign Het
Vmn1r90 G A 7: 14,563,294 probably benign Het
Xpo4 C T 14: 57,643,033 probably benign Het
Zbtb21 A T 16: 97,952,763 Y135N probably damaging Het
Zbtb22 T A 17: 33,918,168 V429D probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zhx1 T C 15: 58,052,921 E643G possibly damaging Het
Zzef1 C T 11: 72,875,053 H1469Y probably benign Het
Other mutations in Wbp2nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Wbp2nl APN 15 82314210 missense probably benign 0.03
IGL01074:Wbp2nl APN 15 82314290 missense possibly damaging 0.73
IGL01295:Wbp2nl APN 15 82306418 missense probably damaging 1.00
IGL01621:Wbp2nl APN 15 82308605 missense probably benign
IGL01735:Wbp2nl APN 15 82313816 missense probably benign
IGL01987:Wbp2nl APN 15 82308561 missense probably benign 0.03
IGL02426:Wbp2nl APN 15 82306173 missense probably damaging 1.00
IGL02900:Wbp2nl APN 15 82313834 missense probably benign
IGL02971:Wbp2nl APN 15 82305744 missense possibly damaging 0.61
R0194:Wbp2nl UTSW 15 82314282 missense possibly damaging 0.93
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0909:Wbp2nl UTSW 15 82314074 missense probably benign 0.41
R1442:Wbp2nl UTSW 15 82314206 missense probably benign
R1753:Wbp2nl UTSW 15 82305744 missense probably damaging 0.97
R4085:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4087:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4726:Wbp2nl UTSW 15 82306054 missense probably damaging 1.00
R4840:Wbp2nl UTSW 15 82314336 missense possibly damaging 0.96
R6338:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6339:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6820:Wbp2nl UTSW 15 82313795 missense possibly damaging 0.65
R7156:Wbp2nl UTSW 15 82305702 missense probably damaging 1.00
R7323:Wbp2nl UTSW 15 82314341 makesense probably null
R7598:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R7857:Wbp2nl UTSW 15 82306072 missense probably benign 0.24
R7903:Wbp2nl UTSW 15 82306131 nonsense probably null
Z1177:Wbp2nl UTSW 15 82308564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTTAAGGAAAGGATCACG -3'
(R):5'- AGTCCAGGCACTTGCTTACTC -3'

Sequencing Primer
(F):5'- AGGATCACGTGTATTTCTTAACCTGG -3'
(R):5'- AGGCACTTGCTTACTCTCTACTGG -3'
Posted On2015-05-15