Mutagenetix > Incidental Mutation

Incidental Mutation 'R4086:Slc14a2'

317396

Institutional Source

Beutler Lab

Gene Symbol

Slc14a2

Ensembl Gene

ENSMUSG00000024552

Gene Name

solute carrier family 14 (urea transporter), member 2

Synonyms

UT-A5, UT-A3

MMRRC Submission

041625-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4086 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78146940-78209094 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78205783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 156 (I156N)

Ref Sequence

ENSEMBL: ENSMUSP00000025434 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000025434
AA Change: I156N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: I156N

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:UT	128	423	1.9e-105	PFAM
low complexity region	460	471	N/A	INTRINSIC
Pfam:UT	591	886	7.5e-112	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163367
AA Change: I18N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552
AA Change: I18N

Domain	Start	End	E-Value	Type
Pfam:UT	1	292	3.4e-113	PFAM

Meta Mutation Damage Score

0.1087

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd7	G	A	2: 3,340,451		probably null	Het
Acss3	T	G	10: 107,053,452	Y169S	probably damaging	Het
Adcy7	A	G	8: 88,315,786	D427G	probably benign	Het
Adrm1	A	G	2: 180,172,834		probably benign	Het
Arfgef1	T	C	1: 10,163,759	I1103M	probably benign	Het
Arhgap32	A	C	9: 32,247,066		probably benign	Het
Arhgef28	T	C	13: 97,967,204	R767G	probably damaging	Het
BC046251	A	G	7: 65,582,148		noncoding transcript	Het
Brwd1	T	C	16: 96,046,372	S683G	probably benign	Het
Calcoco1	C	G	15: 102,710,399		probably benign	Het
Carmil1	G	T	13: 24,024,461	P834T	possibly damaging	Het
Cldn34c4	A	T	X: 127,721,388	V153E	probably damaging	Het
Col24a1	G	A	3: 145,461,437	G1090R	probably damaging	Het
Csmd1	T	A	8: 15,992,738	I2332F	probably damaging	Het
Ets2	C	A	16: 95,709,789	D30E	probably damaging	Het
Fam181b	T	C	7: 93,080,580	V187A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fbxo41	C	T	6: 85,478,546	R552Q	possibly damaging	Het
Fstl5	G	T	3: 76,648,286	C53F	probably damaging	Het
Ftsj3	T	C	11: 106,249,569	Y791C	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm15446	A	G	5: 109,943,255	K458E	probably benign	Het
Hecw2	T	C	1: 53,831,656	I1389V	probably damaging	Het
Ipo9	A	G	1: 135,388,690		probably benign	Het
Krtap31-1	C	T	11: 99,908,319	T116I	possibly damaging	Het
Mafa	T	G	15: 75,747,137	K262N	probably damaging	Het
Nxph4	T	C	10: 127,526,686	Y112C	probably damaging	Het
Olfr814	A	G	10: 129,874,298	V153A	possibly damaging	Het
Olfr987	C	A	2: 85,331,826	W24L	probably benign	Het
Pgls	G	A	8: 71,596,090	A142T	probably damaging	Het
Phlpp1	A	G	1: 106,347,161	I885V	probably benign	Het
Prkcq	A	G	2: 11,283,868	D544G	probably damaging	Het
Rnf44	T	C	13: 54,682,335	N254D	possibly damaging	Het
Sept10	A	T	10: 59,192,223	L92*	probably null	Het
Sos1	A	G	17: 80,449,352	V257A	probably benign	Het
Sypl2	A	G	3: 108,217,676	I123T	possibly damaging	Het
Thap12	A	G	7: 98,716,494	D623G	possibly damaging	Het
Traf3ip3	A	G	1: 193,181,320	V414A	probably damaging	Het
Trim14	T	A	4: 46,523,709	T110S	probably benign	Het
Trim30d	T	C	7: 104,487,800	N66D	probably damaging	Het
Trim65	G	A	11: 116,126,479	Q386*	probably null	Het
Ube2u	T	A	4: 100,549,842	I187N	probably benign	Het
Vmn1r90	G	A	7: 14,563,294		probably benign	Het
Wbp2nl	A	G	15: 82,308,561	M149V	probably benign	Het
Xpo4	C	T	14: 57,643,033		probably benign	Het
Zbtb21	A	T	16: 97,952,763	Y135N	probably damaging	Het
Zbtb22	T	A	17: 33,918,168	V429D	probably damaging	Het
Zfp281	T	A	1: 136,626,121	I279N	probably damaging	Het
Zhx1	T	C	15: 58,052,921	E643G	possibly damaging	Het
Zzef1	C	T	11: 72,875,053	H1469Y	probably benign	Het

Other mutations in Slc14a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Slc14a2	APN	18	78150438	missense	possibly damaging	0.65
IGL00763:Slc14a2	APN	18	78192238	missense	probably damaging	1.00
IGL01359:Slc14a2	APN	18	78154108	missense	probably benign	0.01
IGL01400:Slc14a2	APN	18	78192213	missense	probably damaging	1.00
IGL01450:Slc14a2	APN	18	78183530	missense	probably damaging	0.97
IGL01469:Slc14a2	APN	18	78155566	missense	probably damaging	0.98
IGL02231:Slc14a2	APN	18	78209021	missense	possibly damaging	0.92
IGL02340:Slc14a2	APN	18	78163126	missense	probably damaging	1.00
IGL02542:Slc14a2	APN	18	78209087	missense	probably benign
xi_ning	UTSW	18	78195747	missense	probably benign	0.01
IGL02991:Slc14a2	UTSW	18	78205834	start codon destroyed	probably null	0.77
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0132:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0601:Slc14a2	UTSW	18	78157179	nonsense	probably null
R1677:Slc14a2	UTSW	18	78163204	missense	probably benign
R1749:Slc14a2	UTSW	18	78147080	missense	possibly damaging	0.67
R2014:Slc14a2	UTSW	18	78150386	splice site	probably benign
R2034:Slc14a2	UTSW	18	78183583	missense	probably damaging	0.99
R2264:Slc14a2	UTSW	18	78163089	splice site	probably benign
R2278:Slc14a2	UTSW	18	78159944	missense	probably benign	0.01
R2920:Slc14a2	UTSW	18	78158297	nonsense	probably null
R3878:Slc14a2	UTSW	18	78159074	missense	probably benign
R4237:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4238:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4239:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4300:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4373:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4375:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4376:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4440:Slc14a2	UTSW	18	78195747	missense	probably benign	0.01
R4551:Slc14a2	UTSW	18	78195853	missense	probably benign	0.02
R4636:Slc14a2	UTSW	18	78195792	missense	possibly damaging	0.88
R4749:Slc14a2	UTSW	18	78155581	missense	probably damaging	1.00
R4921:Slc14a2	UTSW	18	78192188	missense	probably damaging	0.97
R4983:Slc14a2	UTSW	18	78150401	missense	probably damaging	0.98
R5114:Slc14a2	UTSW	18	78195748	missense	possibly damaging	0.62
R5164:Slc14a2	UTSW	18	78157272	missense	probably damaging	1.00
R5386:Slc14a2	UTSW	18	78185840	missense	possibly damaging	0.65
R5433:Slc14a2	UTSW	18	78208928	missense	probably damaging	1.00
R5558:Slc14a2	UTSW	18	78159166	missense	possibly damaging	0.94
R5571:Slc14a2	UTSW	18	78209067	missense	possibly damaging	0.73
R5693:Slc14a2	UTSW	18	78147014	missense	probably benign	0.23
R5715:Slc14a2	UTSW	18	78158336	missense	probably damaging	1.00
R5719:Slc14a2	UTSW	18	78209042	missense	probably benign	0.06
R6160:Slc14a2	UTSW	18	78158975	critical splice donor site	probably null
R6352:Slc14a2	UTSW	18	78209094	start codon destroyed	probably null
R6380:Slc14a2	UTSW	18	78146975	missense	probably benign	0.00
R6444:Slc14a2	UTSW	18	78154102	missense	probably damaging	0.98
R6480:Slc14a2	UTSW	18	78159082	missense	possibly damaging	0.80
R6732:Slc14a2	UTSW	18	78192174	missense	probably damaging	1.00
R7038:Slc14a2	UTSW	18	78159037	missense	probably damaging	0.98
R7553:Slc14a2	UTSW	18	78155588	missense	probably damaging	1.00
R7558:Slc14a2	UTSW	18	78192119	missense	probably benign	0.07
R7617:Slc14a2	UTSW	18	78159941	missense	probably benign
R7693:Slc14a2	UTSW	18	78154003	missense	possibly damaging	0.81
R7874:Slc14a2	UTSW	18	78160768	missense	probably benign	0.01
R8144:Slc14a2	UTSW	18	78184544	critical splice donor site	probably null
R9205:Slc14a2	UTSW	18	78195736	missense	probably benign	0.19
R9356:Slc14a2	UTSW	18	78184608	missense	probably null	0.02
Z1088:Slc14a2	UTSW	18	78195780	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157368	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157369	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- GCTGCTAGGATAAGGTTGGC -3'
(R):5'- CCAGGCCAGGCTGAATAAAG -3'

Sequencing Primer
(F):5'- TTGGCTGAGCACTAAATGAAACAC -3'
(R):5'- GAAATACCCTGACTGGTGCATCG -3'

Posted On

2015-05-15