Incidental Mutation 'R4087:Zfp281'
ID317400
Institutional Source Beutler Lab
Gene Symbol Zfp281
Ensembl Gene ENSMUSG00000041483
Gene Namezinc finger protein 281
Synonyms
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136624901-136630053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136626121 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 279 (I279N)
Ref Sequence ENSEMBL: ENSMUSP00000107677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047734] [ENSMUST00000112046]
Predicted Effect probably damaging
Transcript: ENSMUST00000047734
AA Change: I279N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039003
Gene: ENSMUSG00000041483
AA Change: I279N

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 161 171 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
ZnF_C2H2 258 280 3.34e-2 SMART
ZnF_C2H2 286 308 6.78e-3 SMART
ZnF_C2H2 314 336 1.43e-1 SMART
ZnF_C2H2 342 362 2.97e1 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112046
AA Change: I279N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107677
Gene: ENSMUSG00000041483
AA Change: I279N

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 161 171 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
ZnF_C2H2 258 280 3.34e-2 SMART
ZnF_C2H2 286 308 6.78e-3 SMART
ZnF_C2H2 314 336 1.43e-1 SMART
ZnF_C2H2 342 362 2.97e1 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180797
Meta Mutation Damage Score 0.7481 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E7.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Other mutations in Zfp281
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Zfp281 APN 1 136627910 missense probably damaging 1.00
IGL01408:Zfp281 APN 1 136626115 missense probably damaging 1.00
IGL02037:Zfp281 APN 1 136627447 missense possibly damaging 0.64
IGL03233:Zfp281 APN 1 136626829 missense possibly damaging 0.82
PIT4486001:Zfp281 UTSW 1 136627003 missense possibly damaging 0.48
R1514:Zfp281 UTSW 1 136626697 missense probably benign 0.00
R1784:Zfp281 UTSW 1 136625353 small insertion probably benign
R1785:Zfp281 UTSW 1 136625353 small insertion probably benign
R2049:Zfp281 UTSW 1 136625353 small insertion probably benign
R2142:Zfp281 UTSW 1 136625353 small insertion probably benign
R4086:Zfp281 UTSW 1 136626121 missense probably damaging 1.00
R4088:Zfp281 UTSW 1 136626121 missense probably damaging 1.00
R4090:Zfp281 UTSW 1 136626121 missense probably damaging 1.00
R4819:Zfp281 UTSW 1 136625710 missense probably benign
R5380:Zfp281 UTSW 1 136625938 missense possibly damaging 0.93
R6033:Zfp281 UTSW 1 136626726 missense probably benign 0.14
R6033:Zfp281 UTSW 1 136626726 missense probably benign 0.14
R6056:Zfp281 UTSW 1 136625440 missense possibly damaging 0.93
R6213:Zfp281 UTSW 1 136625512 missense probably benign 0.01
R7402:Zfp281 UTSW 1 136625452 missense probably damaging 0.99
R7503:Zfp281 UTSW 1 136626940 missense possibly damaging 0.67
R7969:Zfp281 UTSW 1 136626034 missense probably benign 0.06
R8343:Zfp281 UTSW 1 136627882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCAGAATCTCAGGGAATC -3'
(R):5'- TGCTTCAACAATCTGTCAGTCC -3'

Sequencing Primer
(F):5'- TCTCAGGGAATCAAAGCCAAG -3'
(R):5'- ACTGTTGGCAAGTGTCACAC -3'
Posted On2015-05-15