Incidental Mutation 'R4087:Traf3ip3'
ID317404
Institutional Source Beutler Lab
Gene Symbol Traf3ip3
Ensembl Gene ENSMUSG00000037318
Gene NameTRAF3 interacting protein 3
Synonyms6030423D04Rik
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location193175453-193201703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 193181320 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 414 (V414A)
Ref Sequence ENSEMBL: ENSMUSP00000141698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043550] [ENSMUST00000159666] [ENSMUST00000160822] [ENSMUST00000178744] [ENSMUST00000192020] [ENSMUST00000194278]
Predicted Effect probably damaging
Transcript: ENSMUST00000043550
AA Change: V414A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040977
Gene: ENSMUSG00000037318
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159666
Predicted Effect unknown
Transcript: ENSMUST00000160302
AA Change: V116A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160332
Predicted Effect probably benign
Transcript: ENSMUST00000160822
SMART Domains Protein: ENSMUSP00000124546
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 15 263 2.7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161403
Predicted Effect probably benign
Transcript: ENSMUST00000162480
Predicted Effect probably benign
Transcript: ENSMUST00000178744
SMART Domains Protein: ENSMUSP00000136653
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192020
AA Change: V414A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141698
Gene: ENSMUSG00000037318
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194278
SMART Domains Protein: ENSMUSP00000141661
Gene: ENSMUSG00000037318

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Meta Mutation Damage Score 0.0970 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that mediates cell growth by modulating the c-Jun N-terminal kinase signal transduction pathway. The encoded protein may also interact with a large multi-protein assembly containing the phosphatase 2A catalytic subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired single positive thymocyte development and increased gamma-delta T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Traf3ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Traf3ip3 APN 1 193194820 intron probably benign
IGL00663:Traf3ip3 APN 1 193187138 missense probably damaging 1.00
IGL01125:Traf3ip3 APN 1 193184464 splice site probably null
IGL01308:Traf3ip3 APN 1 193184891 missense probably damaging 1.00
IGL01608:Traf3ip3 APN 1 193187110 missense probably benign 0.00
IGL02225:Traf3ip3 APN 1 193195100 missense probably benign 0.03
IGL02432:Traf3ip3 APN 1 193184576 missense probably damaging 1.00
IGL03102:Traf3ip3 APN 1 193195077 missense probably damaging 1.00
IGL03179:Traf3ip3 APN 1 193194368 missense probably damaging 1.00
IGL02988:Traf3ip3 UTSW 1 193194874 unclassified probably null
R0110:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0469:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0510:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0529:Traf3ip3 UTSW 1 193194811 intron probably benign
R1165:Traf3ip3 UTSW 1 193184478 missense probably damaging 0.99
R1559:Traf3ip3 UTSW 1 193178291 missense probably damaging 0.99
R1729:Traf3ip3 UTSW 1 193181893 missense probably benign 0.01
R1896:Traf3ip3 UTSW 1 193175734 missense probably benign
R4085:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4086:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4088:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4090:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4258:Traf3ip3 UTSW 1 193197946 missense probably damaging 1.00
R4817:Traf3ip3 UTSW 1 193184829 missense probably damaging 1.00
R5299:Traf3ip3 UTSW 1 193178175 nonsense probably null
R5906:Traf3ip3 UTSW 1 193198006 missense possibly damaging 0.55
R6268:Traf3ip3 UTSW 1 193198036 start gained probably benign
R6374:Traf3ip3 UTSW 1 193182010 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTGCAGATGATCCCTCAGC -3'
(R):5'- CTGAAAGGACCCACTAGTGTGTG -3'

Sequencing Primer
(F):5'- GATGATCCCTCAGCCCAGC -3'
(R):5'- CCTGTGTGAATGCTGGCCTC -3'
Posted On2015-05-15