Incidental Mutation 'R4087:Fam171a1'
ID317405
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Namefamily with sequence similarity 171, member A1
Synonyms
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4087 (G1)
Quality Score197
Status Validated
Chromosome2
Chromosomal Location3114224-3227806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3226296 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 697 (R697Q)
Ref Sequence ENSEMBL: ENSMUSP00000072724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062934
AA Change: R817Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: R817Q

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072955
AA Change: R697Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: R697Q

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115099
AA Change: R822Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: R822Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Meta Mutation Damage Score 0.1745 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAATGAACCAAAATCTGCCCGG -3'
(R):5'- ATCAAGGGCCTTTCCTCTCG -3'

Sequencing Primer
(F):5'- GACCCTTTGTCTCTCCAGCAG -3'
(R):5'- CTCTCGTTTCTGCCAGGGG -3'
Posted On2015-05-15