Incidental Mutation 'R4087:Rxfp1'
ID 317412
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Name relaxin/insulin-like family peptide receptor 1
Synonyms LOC381489, Lgr7
MMRRC Submission 040980-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # R4087 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 79548918-79645187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79552256 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 682 (T682S)
Ref Sequence ENSEMBL: ENSMUSP00000077611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
AlphaFold Q6R6I7
Predicted Effect probably damaging
Transcript: ENSMUST00000078527
AA Change: T682S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: T682S

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182491
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Meta Mutation Damage Score 0.2371 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,473,678 (GRCm39) S80P probably damaging Het
Acss3 T G 10: 106,889,313 (GRCm39) Y169S probably damaging Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Cldn34c4 A T X: 126,629,011 (GRCm39) V153E probably damaging Het
Col4a4 T A 1: 82,501,643 (GRCm39) Y370F unknown Het
Col6a6 A T 9: 105,661,155 (GRCm39) I318N possibly damaging Het
Csmd1 T A 8: 16,042,738 (GRCm39) I2332F probably damaging Het
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Dym T A 18: 75,363,172 (GRCm39) Y559N probably damaging Het
Eif3g A G 9: 20,809,248 (GRCm39) V59A possibly damaging Het
Fam171a1 G A 2: 3,227,333 (GRCm39) R697Q probably damaging Het
Fermt3 T A 19: 6,980,945 (GRCm39) probably null Het
Git2 A G 5: 114,902,466 (GRCm39) Y189H probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm7713 C T 15: 59,866,258 (GRCm39) noncoding transcript Het
Gpr108 A G 17: 57,544,925 (GRCm39) Y313H probably damaging Het
Itprid2 C T 2: 79,488,691 (GRCm39) Q925* probably null Het
Kcnh8 T C 17: 53,110,428 (GRCm39) I213T possibly damaging Het
Lpgat1 A T 1: 191,495,728 (GRCm39) I306F possibly damaging Het
Mapk8 T C 14: 33,112,205 (GRCm39) T228A probably benign Het
Med12l T C 3: 59,205,342 (GRCm39) V2101A probably benign Het
Mettl13 T C 1: 162,375,771 (GRCm39) K19E possibly damaging Het
Mta1 A G 12: 113,075,802 (GRCm39) Y22C probably damaging Het
Notch3 T C 17: 32,377,087 (GRCm39) T273A possibly damaging Het
Notch4 T C 17: 34,803,409 (GRCm39) W1443R probably damaging Het
Npy5r T A 8: 67,134,697 (GRCm39) D32V probably damaging Het
Or8k36-ps1 C A 2: 86,437,297 (GRCm39) *206L probably null Het
Rbm47 A G 5: 66,180,080 (GRCm39) M409T probably benign Het
Rnf144a C T 12: 26,377,591 (GRCm39) V51I probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,598,664 (GRCm39) probably null Het
Sos1 A G 17: 80,756,781 (GRCm39) V257A probably benign Het
Tdrd9 C T 12: 111,979,920 (GRCm39) Q256* probably null Het
Tmprss11d A T 5: 86,457,138 (GRCm39) S174T probably damaging Het
Tor1b T A 2: 30,846,531 (GRCm39) I238N probably damaging Het
Tppp2 T C 14: 52,156,957 (GRCm39) probably null Het
Traf3ip3 A G 1: 192,863,628 (GRCm39) V414A probably damaging Het
Trim14 T A 4: 46,523,709 (GRCm39) T110S probably benign Het
Trim30d T C 7: 104,137,007 (GRCm39) N66D probably damaging Het
Usp48 A G 4: 137,350,651 (GRCm39) N46S possibly damaging Het
Vmn2r115 A C 17: 23,565,358 (GRCm39) Q415P probably benign Het
Wbp2nl A G 15: 82,192,762 (GRCm39) M149V probably benign Het
Zfp106 T C 2: 120,357,380 (GRCm39) probably null Het
Zfp281 T A 1: 136,553,859 (GRCm39) I279N probably damaging Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79,559,523 (GRCm39) missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79,594,175 (GRCm39) missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79,567,385 (GRCm39) missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79,567,403 (GRCm39) missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79,557,799 (GRCm39) missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79,567,427 (GRCm39) missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79,559,474 (GRCm39) critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79,578,153 (GRCm39) critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79,559,533 (GRCm39) missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79,574,990 (GRCm39) missense probably benign 0.29
juggler UTSW 3 79,557,898 (GRCm39) nonsense probably null
R0123:Rxfp1 UTSW 3 79,564,783 (GRCm39) missense probably damaging 1.00
R0134:Rxfp1 UTSW 3 79,564,783 (GRCm39) missense probably damaging 1.00
R0230:Rxfp1 UTSW 3 79,552,282 (GRCm39) missense probably damaging 1.00
R0257:Rxfp1 UTSW 3 79,589,842 (GRCm39) missense possibly damaging 0.61
R0265:Rxfp1 UTSW 3 79,574,961 (GRCm39) missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79,645,100 (GRCm39) start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79,559,684 (GRCm39) missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79,558,038 (GRCm39) missense probably benign 0.00
R0547:Rxfp1 UTSW 3 79,612,876 (GRCm39) splice site probably null
R0627:Rxfp1 UTSW 3 79,555,518 (GRCm39) missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79,570,600 (GRCm39) splice site probably null
R1309:Rxfp1 UTSW 3 79,570,599 (GRCm39) splice site probably null
R1756:Rxfp1 UTSW 3 79,578,188 (GRCm39) missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79,645,076 (GRCm39) missense probably benign
R2415:Rxfp1 UTSW 3 79,570,626 (GRCm39) missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79,589,778 (GRCm39) missense possibly damaging 0.80
R4091:Rxfp1 UTSW 3 79,552,068 (GRCm39) missense probably benign
R4250:Rxfp1 UTSW 3 79,559,579 (GRCm39) missense probably benign 0.41
R4335:Rxfp1 UTSW 3 79,594,105 (GRCm39) critical splice donor site probably null
R4447:Rxfp1 UTSW 3 79,559,434 (GRCm39) intron probably benign
R4607:Rxfp1 UTSW 3 79,594,196 (GRCm39) missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79,594,196 (GRCm39) missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79,612,975 (GRCm39) missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79,594,175 (GRCm39) missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79,557,889 (GRCm39) missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79,552,109 (GRCm39) missense probably benign
R5059:Rxfp1 UTSW 3 79,570,619 (GRCm39) missense probably benign
R5131:Rxfp1 UTSW 3 79,559,471 (GRCm39) splice site probably null
R5641:Rxfp1 UTSW 3 79,594,199 (GRCm39) missense probably damaging 0.98
R5711:Rxfp1 UTSW 3 79,586,054 (GRCm39) missense probably damaging 1.00
R5757:Rxfp1 UTSW 3 79,568,627 (GRCm39) missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79,570,620 (GRCm39) missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79,575,155 (GRCm39) missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79,555,596 (GRCm39) missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79,557,898 (GRCm39) nonsense probably null
R7059:Rxfp1 UTSW 3 79,559,576 (GRCm39) missense probably damaging 1.00
R7530:Rxfp1 UTSW 3 79,557,768 (GRCm39) missense probably benign 0.18
R7626:Rxfp1 UTSW 3 79,555,397 (GRCm39) missense probably damaging 0.99
R7684:Rxfp1 UTSW 3 79,578,214 (GRCm39) missense possibly damaging 0.66
R7951:Rxfp1 UTSW 3 79,559,682 (GRCm39) missense probably damaging 1.00
R8723:Rxfp1 UTSW 3 79,557,802 (GRCm39) missense probably benign
R8786:Rxfp1 UTSW 3 79,570,677 (GRCm39) critical splice acceptor site probably null
R8887:Rxfp1 UTSW 3 79,559,289 (GRCm39) intron probably benign
R8939:Rxfp1 UTSW 3 79,552,231 (GRCm39) missense probably damaging 0.99
R9245:Rxfp1 UTSW 3 79,552,261 (GRCm39) missense probably benign 0.12
R9574:Rxfp1 UTSW 3 79,563,581 (GRCm39) missense probably benign 0.01
R9579:Rxfp1 UTSW 3 79,557,946 (GRCm39) missense probably damaging 1.00
R9799:Rxfp1 UTSW 3 79,578,182 (GRCm39) missense probably damaging 1.00
Z1088:Rxfp1 UTSW 3 79,613,011 (GRCm39) missense probably damaging 1.00
Z1177:Rxfp1 UTSW 3 79,559,674 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTAGCGACAGATCACAGGG -3'
(R):5'- CTGGCATTCCTTTAAACACTGACAC -3'

Sequencing Primer
(F):5'- CGACAGATCACAGGGGTCTG -3'
(R):5'- AAGACATCCTGTAAATAACTTGGTG -3'
Posted On 2015-05-15