Incidental Mutation 'R4087:Usp48'
ID317414
Institutional Source Beutler Lab
Gene Symbol Usp48
Ensembl Gene ENSMUSG00000043411
Gene Nameubiquitin specific peptidase 48
SynonymsUsp31, D330022K21Rik, 2810449C13Rik
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137593755-137658537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137623340 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 46 (N46S)
Ref Sequence ENSEMBL: ENSMUSP00000101464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105837] [ENSMUST00000105838] [ENSMUST00000105839] [ENSMUST00000105840]
Predicted Effect probably benign
Transcript: ENSMUST00000055131
AA Change: N571S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: N571S

DomainStartEndE-ValueType
Pfam:UCH 88 417 6.9e-44 PFAM
Pfam:UCH_1 89 374 1e-22 PFAM
Blast:DUSP 479 555 5e-39 BLAST
coiled coil region 622 643 N/A INTRINSIC
UBQ 954 1022 4.78e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105837
AA Change: N46S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101463
Gene: ENSMUSG00000043411
AA Change: N46S

DomainStartEndE-ValueType
Blast:DUSP 1 30 3e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000105838
AA Change: N46S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101464
Gene: ENSMUSG00000043411
AA Change: N46S

DomainStartEndE-ValueType
Blast:DUSP 1 30 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105839
AA Change: N572S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101465
Gene: ENSMUSG00000043411
AA Change: N572S

DomainStartEndE-ValueType
Pfam:UCH 88 418 3.2e-47 PFAM
Pfam:UCH_1 89 374 1.1e-25 PFAM
Blast:DUSP 480 556 5e-40 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105840
AA Change: N572S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: N572S

DomainStartEndE-ValueType
Pfam:UCH 88 418 6.4e-49 PFAM
Pfam:UCH_1 89 374 1.8e-27 PFAM
Blast:DUSP 480 556 4e-39 BLAST
coiled coil region 624 645 N/A INTRINSIC
Blast:DUSP 743 824 2e-7 BLAST
UBQ 938 1006 4.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128065
SMART Domains Protein: ENSMUSP00000115533
Gene: ENSMUSG00000043411

DomainStartEndE-ValueType
Blast:DUSP 9 111 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154395
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Usp48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Usp48 APN 4 137623272 critical splice acceptor site probably null
IGL01864:Usp48 APN 4 137639227 missense possibly damaging 0.87
IGL02386:Usp48 APN 4 137604523 missense possibly damaging 0.93
IGL03112:Usp48 APN 4 137608064 missense probably damaging 1.00
IGL03114:Usp48 APN 4 137656125 missense probably damaging 1.00
IGL03406:Usp48 APN 4 137639295 missense possibly damaging 0.90
balfour UTSW 4 137633455 missense probably benign 0.00
burlap UTSW 4 137625276 missense possibly damaging 0.77
fulfillment UTSW 4 137638233 missense probably damaging 1.00
hayao UTSW 4 137633439 nonsense probably null
Mei UTSW 4 137606693 nonsense probably null
miyazaki UTSW 4 137608154 missense probably damaging 1.00
promise UTSW 4 137634921 missense probably damaging 1.00
satsuki UTSW 4 137633126 missense possibly damaging 0.93
Totoro UTSW 4 137594483 missense probably damaging 0.99
IGL02796:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R0050:Usp48 UTSW 4 137613803 missense probably damaging 1.00
R0333:Usp48 UTSW 4 137594483 missense probably damaging 0.99
R0382:Usp48 UTSW 4 137621218 missense probably benign 0.00
R0423:Usp48 UTSW 4 137616411 missense probably benign
R0570:Usp48 UTSW 4 137633126 missense possibly damaging 0.93
R0855:Usp48 UTSW 4 137608154 missense probably damaging 1.00
R0943:Usp48 UTSW 4 137644470 missense possibly damaging 0.92
R1367:Usp48 UTSW 4 137639295 missense possibly damaging 0.90
R1367:Usp48 UTSW 4 137644463 missense probably damaging 1.00
R1689:Usp48 UTSW 4 137656107 splice site probably null
R1725:Usp48 UTSW 4 137633422 nonsense probably null
R2520:Usp48 UTSW 4 137625251 missense probably benign 0.05
R2965:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R2966:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R3026:Usp48 UTSW 4 137594444 missense probably benign 0.06
R3963:Usp48 UTSW 4 137633439 nonsense probably null
R4633:Usp48 UTSW 4 137634900 missense probably damaging 0.96
R4677:Usp48 UTSW 4 137616381 missense probably benign 0.16
R4735:Usp48 UTSW 4 137633369 nonsense probably null
R4932:Usp48 UTSW 4 137615833 missense probably benign 0.00
R4932:Usp48 UTSW 4 137615834 splice site probably null
R4935:Usp48 UTSW 4 137650358 missense probably benign 0.42
R4952:Usp48 UTSW 4 137606693 nonsense probably null
R5034:Usp48 UTSW 4 137606757 nonsense probably null
R5153:Usp48 UTSW 4 137616362 missense possibly damaging 0.68
R5443:Usp48 UTSW 4 137621221 missense possibly damaging 0.78
R5591:Usp48 UTSW 4 137652652 intron probably benign
R5825:Usp48 UTSW 4 137623378 missense probably benign
R5889:Usp48 UTSW 4 137616412 missense probably benign
R5955:Usp48 UTSW 4 137615818 missense probably benign
R6089:Usp48 UTSW 4 137605818 missense probably damaging 1.00
R6443:Usp48 UTSW 4 137613763 missense probably damaging 1.00
R6473:Usp48 UTSW 4 137609108 critical splice donor site probably null
R6482:Usp48 UTSW 4 137634921 missense probably damaging 1.00
R6859:Usp48 UTSW 4 137625276 missense possibly damaging 0.77
R6916:Usp48 UTSW 4 137638233 missense probably damaging 1.00
R6977:Usp48 UTSW 4 137650360 missense probably damaging 1.00
R7749:Usp48 UTSW 4 137650417 missense probably damaging 1.00
R7759:Usp48 UTSW 4 137594452 missense probably benign 0.25
R7767:Usp48 UTSW 4 137604645 critical splice donor site probably null
R7850:Usp48 UTSW 4 137605749 splice site probably null
R7881:Usp48 UTSW 4 137633455 missense probably benign 0.00
R7897:Usp48 UTSW 4 137644428 missense probably damaging 0.96
R8186:Usp48 UTSW 4 137621196 missense possibly damaging 0.83
R8198:Usp48 UTSW 4 137621159 unclassified probably benign
R8506:Usp48 UTSW 4 137610718 missense probably damaging 1.00
RF002:Usp48 UTSW 4 137605795 missense probably damaging 1.00
Z1176:Usp48 UTSW 4 137604637 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGGATACAGATGGATTGTGCTG -3'
(R):5'- AATGTGCTCTTTCATCAGAGTCC -3'

Sequencing Primer
(F):5'- ATGGATTGTGCTGTAAAAATTTGTGC -3'
(R):5'- CTCAGCCTCTAAAGTGCTAGG -3'
Posted On2015-05-15