Incidental Mutation 'R4087:Acss3'
ID317425
Institutional Source Beutler Lab
Gene Symbol Acss3
Ensembl Gene ENSMUSG00000035948
Gene Nameacyl-CoA synthetase short-chain family member 3
SynonymsLOC380660, 8430416H19Rik
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location106933517-107123668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107053452 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 169 (Y169S)
Ref Sequence ENSEMBL: ENSMUSP00000128209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044668] [ENSMUST00000165067]
Predicted Effect probably damaging
Transcript: ENSMUST00000044668
AA Change: Y169S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040823
Gene: ENSMUSG00000035948
AA Change: Y169S

DomainStartEndE-ValueType
Pfam:AMP-binding 112 496 4.6e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165067
AA Change: Y169S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128209
Gene: ENSMUSG00000035948
AA Change: Y169S

DomainStartEndE-ValueType
Pfam:ACAS_N 57 111 8.8e-22 PFAM
Pfam:AMP-binding 113 557 3.2e-81 PFAM
Pfam:AMP-binding_C 565 644 2.2e-22 PFAM
Meta Mutation Damage Score 0.9692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Acss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Acss3 APN 10 106966026 missense probably benign
IGL00941:Acss3 APN 10 107053326 critical splice donor site probably null
IGL00983:Acss3 APN 10 106966964 nonsense probably null
IGL01010:Acss3 APN 10 107023849 splice site probably benign
IGL02227:Acss3 APN 10 107045335 missense probably benign
IGL02296:Acss3 APN 10 107053451 nonsense probably null
IGL02319:Acss3 APN 10 106948750 missense probably damaging 0.99
IGL03181:Acss3 APN 10 107053388 missense probably damaging 1.00
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0279:Acss3 UTSW 10 107084871 missense possibly damaging 0.95
R0418:Acss3 UTSW 10 107023912 missense probably damaging 0.99
R0550:Acss3 UTSW 10 107053471 missense probably damaging 1.00
R1114:Acss3 UTSW 10 106988879 missense possibly damaging 0.89
R1491:Acss3 UTSW 10 106937308 missense probably benign
R1625:Acss3 UTSW 10 106937402 critical splice donor site probably null
R1771:Acss3 UTSW 10 106937200 missense probably damaging 1.00
R1956:Acss3 UTSW 10 106936168 missense probably benign 0.00
R2006:Acss3 UTSW 10 106963010 missense possibly damaging 0.81
R2018:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2019:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2078:Acss3 UTSW 10 106967041 missense possibly damaging 0.94
R2253:Acss3 UTSW 10 107004748 missense probably damaging 1.00
R2391:Acss3 UTSW 10 107123487 missense probably benign 0.00
R3082:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R3083:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R4072:Acss3 UTSW 10 107123585 unclassified probably benign
R4086:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4089:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4090:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4406:Acss3 UTSW 10 107053337 missense probably damaging 1.00
R4607:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4608:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4790:Acss3 UTSW 10 107023702 nonsense probably null
R4834:Acss3 UTSW 10 107084805 critical splice donor site probably null
R5130:Acss3 UTSW 10 107004725 missense possibly damaging 0.87
R5303:Acss3 UTSW 10 107084851 missense possibly damaging 0.74
R5365:Acss3 UTSW 10 107004728 missense probably damaging 1.00
R5439:Acss3 UTSW 10 106937147 nonsense probably null
R5617:Acss3 UTSW 10 106951990 missense probably damaging 1.00
R5698:Acss3 UTSW 10 106948744 missense probably damaging 1.00
R5726:Acss3 UTSW 10 107123322 missense possibly damaging 0.63
R6154:Acss3 UTSW 10 107123349 missense probably benign 0.02
R6298:Acss3 UTSW 10 107084856 missense probably damaging 1.00
R6592:Acss3 UTSW 10 107023718 missense possibly damaging 0.94
R6707:Acss3 UTSW 10 107084922 missense probably damaging 1.00
R6999:Acss3 UTSW 10 107053501 missense probably damaging 1.00
R7567:Acss3 UTSW 10 107123313 missense probably benign 0.00
R8351:Acss3 UTSW 10 107049404 missense probably damaging 0.98
R8451:Acss3 UTSW 10 107049404 missense probably damaging 0.98
R8515:Acss3 UTSW 10 106948663 missense possibly damaging 0.51
X0027:Acss3 UTSW 10 107123344 missense probably benign 0.05
Z1177:Acss3 UTSW 10 107004777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGTTAAGAGATATGCTATAGGC -3'
(R):5'- GAGACACCATTGTTACCACATC -3'

Sequencing Primer
(F):5'- CAGCTGATGACTTGATCCTGAAG -3'
(R):5'- CAAGTCTATTCTCCAAGACTCGTGAG -3'
Posted On2015-05-15