Incidental Mutation 'R4087:Sertad2'
ID317426
Institutional Source Beutler Lab
Gene Symbol Sertad2
Ensembl Gene ENSMUSG00000049800
Gene NameSERTA domain containing 2
SynonymsSei2, Trip-Br2, SEI-2
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R4087 (G1)
Quality Score153
Status Validated
Chromosome11
Chromosomal Location20543253-20653021 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCCC to GCCCCC at 20648664 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093292] [ENSMUST00000109585] [ENSMUST00000109586]
Predicted Effect probably null
Transcript: ENSMUST00000093292
SMART Domains Protein: ENSMUSP00000090981
Gene: ENSMUSG00000049800

DomainStartEndE-ValueType
Pfam:SERTA 40 77 1.6e-20 PFAM
low complexity region 89 99 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109585
SMART Domains Protein: ENSMUSP00000105214
Gene: ENSMUSG00000049800

DomainStartEndE-ValueType
Pfam:SERTA 40 77 5.3e-20 PFAM
low complexity region 89 99 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109586
SMART Domains Protein: ENSMUSP00000105215
Gene: ENSMUSG00000049800

DomainStartEndE-ValueType
Pfam:SERTA 40 77 5.3e-20 PFAM
low complexity region 89 99 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced lipolysis, thermogenesis, and oxidative metabolism with resistance to diet induced obesity and steatosis and improved when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Sertad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03008:Sertad2 APN 11 20647798 splice site probably benign
wisteria UTSW 11 20648664 frame shift probably null
PIT4366001:Sertad2 UTSW 11 20648116 missense probably benign 0.03
R1171:Sertad2 UTSW 11 20648091 missense probably benign 0.01
R1306:Sertad2 UTSW 11 20648388 missense probably benign
R3834:Sertad2 UTSW 11 20648482 missense probably benign 0.15
R4940:Sertad2 UTSW 11 20647899 missense possibly damaging 0.52
R5232:Sertad2 UTSW 11 20648344 missense possibly damaging 0.72
R5621:Sertad2 UTSW 11 20648061 missense possibly damaging 0.61
R5891:Sertad2 UTSW 11 20647884 missense probably benign 0.30
R5956:Sertad2 UTSW 11 20647884 missense probably benign 0.30
R6006:Sertad2 UTSW 11 20647884 missense probably benign 0.30
R6007:Sertad2 UTSW 11 20647884 missense probably benign 0.30
R6048:Sertad2 UTSW 11 20648436 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTTTCCTGACAGACTTGAC -3'
(R):5'- AAGGCACTCCAACTCTGCTTG -3'

Sequencing Primer
(F):5'- AGACTTGACCCTGGATGACATCTTG -3'
(R):5'- GCTTGAAGAAAATACTAGTGTGATCC -3'
Posted On2015-05-15