Incidental Mutation 'R4087:Mapk8'
ID317430
Institutional Source Beutler Lab
Gene Symbol Mapk8
Ensembl Gene ENSMUSG00000021936
Gene Namemitogen-activated protein kinase 8
SynonymsJNK1, c-Jun N-terminal kinase, Prkm8
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33377898-33447158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33390248 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 228 (T228A)
Ref Sequence ENSEMBL: ENSMUSP00000107574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022504] [ENSMUST00000111942] [ENSMUST00000111943] [ENSMUST00000111944] [ENSMUST00000111945] [ENSMUST00000226798]
Predicted Effect probably benign
Transcript: ENSMUST00000022504
AA Change: T228A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022504
Gene: ENSMUSG00000021936
AA Change: T228A

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111942
SMART Domains Protein: ENSMUSP00000107573
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 208 1.8e-25 PFAM
Pfam:Pkinase 26 210 5.2e-48 PFAM
Pfam:Kdo 33 178 6.4e-9 PFAM
SCOP:d1pme__ 216 286 2e-17 SMART
PDB:3GP0|A 218 288 4e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111943
AA Change: T228A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107574
Gene: ENSMUSG00000021936
AA Change: T228A

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111944
SMART Domains Protein: ENSMUSP00000107575
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111945
SMART Domains Protein: ENSMUSP00000107576
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150659
Predicted Effect probably benign
Transcript: ENSMUST00000226798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227306
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal T cell differentiation and proliferation, cardiac morphology and physiology, and chemically-induced tumorigenesis. Mice homozygous for another knock-out allele exhibit abnormal glucose homeostasis and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Mapk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Mapk8 APN 14 33383900 missense probably benign 0.01
R0255:Mapk8 UTSW 14 33387307 splice site probably benign
R0401:Mapk8 UTSW 14 33382208 missense probably benign 0.37
R0862:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R0864:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R1084:Mapk8 UTSW 14 33388803 nonsense probably null
R1637:Mapk8 UTSW 14 33410962 missense probably benign 0.00
R2038:Mapk8 UTSW 14 33388936 nonsense probably null
R3959:Mapk8 UTSW 14 33382253 missense probably null 0.21
R4181:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4183:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4184:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R5366:Mapk8 UTSW 14 33390729 missense probably damaging 1.00
R6076:Mapk8 UTSW 14 33390293 missense probably damaging 1.00
R6991:Mapk8 UTSW 14 33410884 missense possibly damaging 0.82
R7345:Mapk8 UTSW 14 33408111 missense probably damaging 0.99
R7814:Mapk8 UTSW 14 33410877 nonsense probably null
R8194:Mapk8 UTSW 14 33382284 missense probably benign
Z1176:Mapk8 UTSW 14 33410886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTATGAATTAACCACACTTGAGAC -3'
(R):5'- GTCAGCACATTCACCGTCATTC -3'

Sequencing Primer
(F):5'- GAATTAACCACACTTGAGACCTTTTC -3'
(R):5'- ACATTCACCGTCATTCATTTTTATTT -3'
Posted On2015-05-15