Incidental Mutation 'R4087:Wbp2nl'
ID 317433
Institutional Source Beutler Lab
Gene Symbol Wbp2nl
Ensembl Gene ENSMUSG00000022455
Gene Name WBP2 N-terminal like
Synonyms 4930521I23Rik, PAWP
MMRRC Submission 040980-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4087 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 82298954-82314623 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82308561 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 149 (M149V)
Ref Sequence ENSEMBL: ENSMUSP00000023089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023089]
AlphaFold Q9D529
Predicted Effect probably benign
Transcript: ENSMUST00000023089
AA Change: M149V

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023089
Gene: ENSMUSG00000022455
AA Change: M149V

DomainStartEndE-ValueType
Pfam:GRAM 4 87 1e-9 PFAM
Pfam:WWbp 103 226 2e-23 PFAM
low complexity region 238 262 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WBP2NL is a sperm-specific WW domain-binding protein that promotes meiotic resumption and pronuclear development during oocyte fertilization (Wu et al., 2007 [PubMed 17289678]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit normal sperm morphology, acrosomal reaction, egg activation and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Wbp2nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Wbp2nl APN 15 82314210 missense probably benign 0.03
IGL01074:Wbp2nl APN 15 82314290 missense possibly damaging 0.73
IGL01295:Wbp2nl APN 15 82306418 missense probably damaging 1.00
IGL01621:Wbp2nl APN 15 82308605 missense probably benign
IGL01735:Wbp2nl APN 15 82313816 missense probably benign
IGL01987:Wbp2nl APN 15 82308561 missense probably benign 0.03
IGL02426:Wbp2nl APN 15 82306173 missense probably damaging 1.00
IGL02900:Wbp2nl APN 15 82313834 missense probably benign
IGL02971:Wbp2nl APN 15 82305744 missense possibly damaging 0.61
R0194:Wbp2nl UTSW 15 82314282 missense possibly damaging 0.93
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0909:Wbp2nl UTSW 15 82314074 missense probably benign 0.41
R1442:Wbp2nl UTSW 15 82314206 missense probably benign
R1753:Wbp2nl UTSW 15 82305744 missense probably damaging 0.97
R4085:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4086:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4726:Wbp2nl UTSW 15 82306054 missense probably damaging 1.00
R4840:Wbp2nl UTSW 15 82314336 missense possibly damaging 0.96
R6338:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6339:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6820:Wbp2nl UTSW 15 82313795 missense possibly damaging 0.65
R7156:Wbp2nl UTSW 15 82305702 missense probably damaging 1.00
R7323:Wbp2nl UTSW 15 82314341 makesense probably null
R7598:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R7857:Wbp2nl UTSW 15 82306072 missense probably benign 0.24
R7903:Wbp2nl UTSW 15 82306131 nonsense probably null
R9242:Wbp2nl UTSW 15 82308547 missense probably benign 0.22
R9379:Wbp2nl UTSW 15 82314110 missense possibly damaging 0.83
Z1177:Wbp2nl UTSW 15 82308564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCTTTAAGGAAAGGATCACG -3'
(R):5'- GTCCAGGCACTTGCTTACTC -3'

Sequencing Primer
(F):5'- AGGATCACGTGTATTTCTTAACCTGG -3'
(R):5'- AGGCACTTGCTTACTCTCTACTGG -3'
Posted On 2015-05-15