Incidental Mutation 'R4087:Dnajc28'
ID317434
Institutional Source Beutler Lab
Gene Symbol Dnajc28
Ensembl Gene ENSMUSG00000039763
Gene NameDnaJ heat shock protein family (Hsp40) member C28
SynonymsORF28
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91614254-91619026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91616867 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 187 (T187M)
Ref Sequence ENSEMBL: ENSMUSP00000132288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000049244] [ENSMUST00000133731] [ENSMUST00000143058] [ENSMUST00000156713] [ENSMUST00000169982] [ENSMUST00000232289] [ENSMUST00000232640]
Predicted Effect probably benign
Transcript: ENSMUST00000023684
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049244
AA Change: T163M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048113
Gene: ENSMUSG00000039763
AA Change: T163M

DomainStartEndE-ValueType
DnaJ 47 105 1.04e-11 SMART
low complexity region 112 123 N/A INTRINSIC
Pfam:DUF1992 203 342 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133731
SMART Domains Protein: ENSMUSP00000118526
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 47 84 6.65e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138207
Predicted Effect possibly damaging
Transcript: ENSMUST00000143058
AA Change: T187M

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120318
Gene: ENSMUSG00000039763
AA Change: T187M

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169982
AA Change: T187M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132288
Gene: ENSMUSG00000039763
AA Change: T187M

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Pfam:DUF1992 227 295 1.2e-24 PFAM
coiled coil region 312 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232620
Predicted Effect probably benign
Transcript: ENSMUST00000232640
Predicted Effect probably benign
Transcript: ENSMUST00000232643
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DnaJ heat shock protein family. The encoded protein, which contains a conserved N-terminal DnaJ domain, is thought to play a role in protein folding or act as a molecular chaperone protein. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Dnajc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Dnajc28 APN 16 91616441 missense possibly damaging 0.49
R1199:Dnajc28 UTSW 16 91618642 unclassified probably benign
R2265:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2266:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2276:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2277:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2278:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2364:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2366:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2367:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2447:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3757:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3890:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4088:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4110:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4112:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4113:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R6372:Dnajc28 UTSW 16 91617288 missense probably benign 0.36
R6613:Dnajc28 UTSW 16 91616358 nonsense probably null
R8061:Dnajc28 UTSW 16 91617170 missense possibly damaging 0.70
R8163:Dnajc28 UTSW 16 91616907 nonsense probably null
R8165:Dnajc28 UTSW 16 91616907 nonsense probably null
R8172:Dnajc28 UTSW 16 91616907 nonsense probably null
R8174:Dnajc28 UTSW 16 91616907 nonsense probably null
Z1176:Dnajc28 UTSW 16 91617033 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGCCAGAAAATTTCTTCAGCG -3'
(R):5'- GCTGTCCCATGCGATAAAACG -3'

Sequencing Primer
(F):5'- TTTCCCGCTGAGATTGTCAAAG -3'
(R):5'- TGCGATAAAACGGATGCATGCC -3'
Posted On2015-05-15