Incidental Mutation 'R4087:A530064D06Rik'
ID317438
Institutional Source Beutler Lab
Gene Symbol A530064D06Rik
Ensembl Gene ENSMUSG00000043939
Gene NameRIKEN cDNA A530064D06 gene
Synonyms
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location48151896-48167270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48166510 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 80 (S80P)
Ref Sequence ENSEMBL: ENSMUSP00000027764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027764] [ENSMUST00000053612]
Predicted Effect probably damaging
Transcript: ENSMUST00000027764
AA Change: S80P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027764
Gene: ENSMUSG00000043939
AA Change: S80P

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 1.56e-5 SMART
low complexity region 144 158 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000053612
AA Change: S80P

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055935
Gene: ENSMUSG00000043939
AA Change: S80P

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 1.56e-5 SMART
low complexity region 147 166 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in A530064D06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:A530064D06Rik APN 17 48152940 missense probably damaging 0.99
IGL01761:A530064D06Rik APN 17 48152959 missense possibly damaging 0.91
IGL02001:A530064D06Rik APN 17 48166674 missense possibly damaging 0.74
IGL02995:A530064D06Rik APN 17 48163288 missense probably benign 0.23
IGL03109:A530064D06Rik APN 17 48166460 missense probably benign 0.13
FR4340:A530064D06Rik UTSW 17 48163381 small deletion probably benign
FR4589:A530064D06Rik UTSW 17 48163381 small deletion probably benign
IGL02984:A530064D06Rik UTSW 17 48163280 missense probably benign 0.06
R0206:A530064D06Rik UTSW 17 48163318 missense probably benign 0.00
R0206:A530064D06Rik UTSW 17 48163318 missense probably benign 0.00
R0660:A530064D06Rik UTSW 17 48166591 missense probably benign 0.18
R0664:A530064D06Rik UTSW 17 48166591 missense probably benign 0.18
R0671:A530064D06Rik UTSW 17 48166656 missense probably benign 0.05
R1587:A530064D06Rik UTSW 17 48166417 missense probably benign 0.20
R4089:A530064D06Rik UTSW 17 48166510 missense probably damaging 0.96
R4963:A530064D06Rik UTSW 17 48163414 missense probably benign 0.34
R5060:A530064D06Rik UTSW 17 48166939 missense probably damaging 1.00
R5083:A530064D06Rik UTSW 17 48166390 missense possibly damaging 0.86
R5219:A530064D06Rik UTSW 17 48163350 missense possibly damaging 0.70
R6175:A530064D06Rik UTSW 17 48152848 missense possibly damaging 0.91
R6189:A530064D06Rik UTSW 17 48167054 start gained probably benign
R6420:A530064D06Rik UTSW 17 48166398 missense probably damaging 1.00
R6439:A530064D06Rik UTSW 17 48166485 missense probably damaging 1.00
R7417:A530064D06Rik UTSW 17 48152889 missense probably damaging 1.00
Z1177:A530064D06Rik UTSW 17 48166506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACATCTCTACTAGAGGAAGCTG -3'
(R):5'- CACAGAACCCGGAGTTACTTC -3'

Sequencing Primer
(F):5'- TCAACTCTGGAGCCTTGAGAC -3'
(R):5'- CCGGAGTTACTTCGAACACAGG -3'
Posted On2015-05-15