Incidental Mutation 'R4087:Dym'
ID317441
Institutional Source Beutler Lab
Gene Symbol Dym
Ensembl Gene ENSMUSG00000035765
Gene Namedymeclin
SynonymsC030019K18Rik, 4933427L07Rik, 1810041M12Rik
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location75018772-75286966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75230101 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 559 (Y559N)
Ref Sequence ENSEMBL: ENSMUSP00000047054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039608]
Predicted Effect probably damaging
Transcript: ENSMUST00000039608
AA Change: Y559N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047054
Gene: ENSMUSG00000035765
AA Change: Y559N

DomainStartEndE-ValueType
Pfam:Dymeclin 1 646 3.3e-174 PFAM
Pfam:Hid1 309 584 3e-11 PFAM
Meta Mutation Damage Score 0.9119 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is necessary for normal skeletal development and brain function. Mutations in this gene are associated with two types of recessive osteochondrodysplasia, Dyggve-Melchior-Clausen (DMC) dysplasia and Smith-McCort (SMC) dysplasia, which involve both skeletal defects and mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele display decreased body size with short tubular bones, chondrodysplasia, partial penetrance of obstructive hydronephrosis and impaired vesicular transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Dym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Dym APN 18 75119249 missense probably benign 0.43
IGL01593:Dym APN 18 75114781 splice site probably benign
IGL02657:Dym APN 18 75082456 nonsense probably null
IGL02716:Dym APN 18 75286683 missense probably damaging 1.00
IGL02977:Dym APN 18 75063175 critical splice donor site probably null
asesino UTSW 18 75056641 missense probably damaging 1.00
flavor UTSW 18 75056738 nonsense probably null
geschmack UTSW 18 75063174 critical splice donor site probably null
sabor UTSW 18 75125539 critical splice donor site probably null
R0042:Dym UTSW 18 75125539 critical splice donor site probably null
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0320:Dym UTSW 18 75199262 missense probably damaging 0.99
R0943:Dym UTSW 18 75286769 makesense probably null
R1677:Dym UTSW 18 75125512 missense probably damaging 1.00
R2022:Dym UTSW 18 75080250 missense probably benign 0.05
R2221:Dym UTSW 18 75230165 missense probably damaging 1.00
R2292:Dym UTSW 18 75199212 missense possibly damaging 0.95
R4929:Dym UTSW 18 75243286 missense probably damaging 1.00
R5033:Dym UTSW 18 75119161 missense possibly damaging 0.78
R6489:Dym UTSW 18 75080226 missense probably benign 0.27
R6641:Dym UTSW 18 75056641 missense probably damaging 1.00
R6751:Dym UTSW 18 75286647 missense probably damaging 0.98
R6864:Dym UTSW 18 75056738 nonsense probably null
R7284:Dym UTSW 18 75119171 missense possibly damaging 0.60
R7319:Dym UTSW 18 75063174 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCTGTGGCAGGGACCAAAAC -3'
(R):5'- GCACTCAGAAAGGAGTCTTGG -3'

Sequencing Primer
(F):5'- CCAAAACACTGACTGCTTGTTGGG -3'
(R):5'- TACAGATCCCAGTGCGTCAGAG -3'
Posted On2015-05-15