Incidental Mutation 'R4088:Khdrbs2'
ID317444
Institutional Source Beutler Lab
Gene Symbol Khdrbs2
Ensembl Gene ENSMUSG00000026058
Gene NameKH domain containing, RNA binding, signal transduction associated 2
Synonyms6330586C16Rik, SLM-1
MMRRC Submission 040981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4088 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location32172714-32658568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32333524 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 93 (E93G)
Ref Sequence ENSEMBL: ENSMUSP00000140157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226] [ENSMUST00000188257]
Predicted Effect probably damaging
Transcript: ENSMUST00000027226
AA Change: E93G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058
AA Change: E93G

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186984
Predicted Effect probably damaging
Transcript: ENSMUST00000188257
AA Change: E93G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140157
Gene: ENSMUSG00000026058
AA Change: E93G

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 122 4.04e-3 SMART
low complexity region 180 191 N/A INTRINSIC
Meta Mutation Damage Score 0.1389 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to the src associated in mitosis, 68 kDa protein, which is an RNA-binding protein and a substrate for Src-family tyrosine kinases during mitosis. This protein has a KH RNA-binding motif and proline-rich motifs which may be SH2 and SH3 domain binding sites. A similar rat protein is an RNA-binding protein which is tyrosine phosphorylated by Src during mitosis. These studies also suggest that the rat protein may function as an adaptor protein for Src by binding the SH2 and SH3 domains of various other proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals display smaller brain size and reduced weight in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T C 1: 181,227,709 noncoding transcript Het
Alox12b G T 11: 69,158,385 V87L probably benign Het
Arsk T G 13: 76,098,414 N32T probably benign Het
Baz1b T A 5: 135,216,940 N414K probably damaging Het
Cacna1e A T 1: 154,412,183 probably null Het
Cdc73 A G 1: 143,608,514 probably benign Het
Cdhr2 A G 13: 54,717,888 D233G probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Cyp2b9 T C 7: 26,173,456 L8P probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dnajc6 T A 4: 101,639,396 V920E probably damaging Het
Eef2kmt A T 16: 5,253,035 I50N probably damaging Het
Esyt3 T C 9: 99,324,237 M40V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr26 G T 7: 131,967,076 C50F probably benign Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Hsdl2 T A 4: 59,610,636 L211Q unknown Het
Kif13b T C 14: 64,767,455 probably null Het
Kif15 T A 9: 122,986,189 L423I probably benign Het
Kmt2c A G 5: 25,287,713 V834A probably benign Het
Lama3 T A 18: 12,504,308 Y28* probably null Het
Map4k2 A T 19: 6,353,156 H763L probably damaging Het
Mkl2 T C 16: 13,384,200 F120S probably damaging Het
Ndufs3 C T 2: 90,898,345 probably benign Het
Nfasc A T 1: 132,595,591 V887E probably damaging Het
Npsr1 G A 9: 24,313,769 E358K possibly damaging Het
Nrcam T C 12: 44,572,202 L828P possibly damaging Het
Olfr344 T A 2: 36,569,018 L140H probably damaging Het
Oprm1 T C 10: 6,830,234 Y299H probably damaging Het
Osbpl8 T C 10: 111,289,790 V777A possibly damaging Het
Pcnt T C 10: 76,428,014 E372G probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Sbk2 T C 7: 4,957,628 Y181C probably damaging Het
Sf1 G A 19: 6,368,440 probably null Het
Slc26a9 A G 1: 131,767,849 E765G possibly damaging Het
Stab2 A G 10: 86,922,185 L1073P probably damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar3 A G 10: 23,949,859 D101G possibly damaging Het
Thsd4 T C 9: 59,997,222 R204G probably benign Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ttn G A 2: 76,917,770 Q4312* probably null Het
Ubtfl1 T C 9: 18,409,968 V264A probably damaging Het
Vmn1r58 C A 7: 5,410,655 W192L probably damaging Het
Washc5 C A 15: 59,339,862 C969F probably damaging Het
Zdhhc14 A G 17: 5,726,856 K296R probably benign Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp9 G T 6: 118,464,769 P311T probably damaging Het
Other mutations in Khdrbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Khdrbs2 APN 1 32472752 missense probably benign 0.00
IGL01326:Khdrbs2 APN 1 32657477 missense possibly damaging 0.94
IGL01767:Khdrbs2 APN 1 32619176 nonsense probably null
IGL01792:Khdrbs2 APN 1 32657467 missense probably damaging 0.99
IGL01839:Khdrbs2 APN 1 32414862 splice site probably benign
R0046:Khdrbs2 UTSW 1 32619202 missense possibly damaging 0.56
R0079:Khdrbs2 UTSW 1 32519915 intron probably null
R0396:Khdrbs2 UTSW 1 32519973 missense probably damaging 1.00
R0613:Khdrbs2 UTSW 1 32657522 missense possibly damaging 0.94
R0616:Khdrbs2 UTSW 1 32467775 missense possibly damaging 0.65
R1034:Khdrbs2 UTSW 1 32467791 missense probably damaging 1.00
R1055:Khdrbs2 UTSW 1 32644157 splice site probably benign
R1156:Khdrbs2 UTSW 1 32467875 missense probably benign 0.04
R1456:Khdrbs2 UTSW 1 32520696 missense possibly damaging 0.71
R2007:Khdrbs2 UTSW 1 32520548 missense probably benign 0.04
R2079:Khdrbs2 UTSW 1 32467874 missense probably benign
R2384:Khdrbs2 UTSW 1 32519895 missense probably damaging 0.97
R3123:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3124:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3772:Khdrbs2 UTSW 1 32244076 nonsense probably null
R4078:Khdrbs2 UTSW 1 32519814 intron probably benign
R4955:Khdrbs2 UTSW 1 32520077 intron probably benign
R5465:Khdrbs2 UTSW 1 32619174 missense probably damaging 1.00
R5668:Khdrbs2 UTSW 1 32467770 missense probably damaging 1.00
R5792:Khdrbs2 UTSW 1 32472692 missense probably damaging 1.00
R6639:Khdrbs2 UTSW 1 32467862 nonsense probably null
R7027:Khdrbs2 UTSW 1 32414916 missense probably benign 0.02
R7380:Khdrbs2 UTSW 1 32333604 missense unknown
R7381:Khdrbs2 UTSW 1 32333802 missense not run
X0020:Khdrbs2 UTSW 1 32414974 missense probably damaging 1.00
Z1088:Khdrbs2 UTSW 1 32244055 intron probably benign
Predicted Primers PCR Primer
(F):5'- TAATTTCCAGTGTTCTTGTGTGCAC -3'
(R):5'- GGTACCAGAAAGCAAGCCTC -3'

Sequencing Primer
(F):5'- GTTCTTGTGTGCACATGTAAAAATG -3'
(R):5'- GCCTCATAGAAAACAGGGAACGC -3'
Posted On2015-05-15