Incidental Mutation 'R4088:Sypl2'
ID317458
Institutional Source Beutler Lab
Gene Symbol Sypl2
Ensembl Gene ENSMUSG00000027887
Gene Namesynaptophysin-like 2
SynonymsMg29
MMRRC Submission 040981-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4088 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108211472-108226648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108217676 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 123 (I123T)
Ref Sequence ENSEMBL: ENSMUSP00000116756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141387]
Predicted Effect possibly damaging
Transcript: ENSMUST00000141387
AA Change: I123T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116756
Gene: ENSMUSG00000027887
AA Change: I123T

DomainStartEndE-ValueType
low complexity region 9 65 N/A INTRINSIC
Pfam:MARVEL 107 309 7.2e-41 PFAM
low complexity region 318 326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156371
Meta Mutation Damage Score 0.2995 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile, but exhibit reduced body weight, abnormal skeletal muscle membranes and irregular skeletal muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T C 1: 181,227,709 noncoding transcript Het
Alox12b G T 11: 69,158,385 V87L probably benign Het
Arsk T G 13: 76,098,414 N32T probably benign Het
Baz1b T A 5: 135,216,940 N414K probably damaging Het
Cacna1e A T 1: 154,412,183 probably null Het
Cdc73 A G 1: 143,608,514 probably benign Het
Cdhr2 A G 13: 54,717,888 D233G probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Cyp2b9 T C 7: 26,173,456 L8P probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dnajc6 T A 4: 101,639,396 V920E probably damaging Het
Eef2kmt A T 16: 5,253,035 I50N probably damaging Het
Esyt3 T C 9: 99,324,237 M40V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr26 G T 7: 131,967,076 C50F probably benign Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Hsdl2 T A 4: 59,610,636 L211Q unknown Het
Khdrbs2 A G 1: 32,333,524 E93G probably damaging Het
Kif13b T C 14: 64,767,455 probably null Het
Kif15 T A 9: 122,986,189 L423I probably benign Het
Kmt2c A G 5: 25,287,713 V834A probably benign Het
Lama3 T A 18: 12,504,308 Y28* probably null Het
Map4k2 A T 19: 6,353,156 H763L probably damaging Het
Mkl2 T C 16: 13,384,200 F120S probably damaging Het
Ndufs3 C T 2: 90,898,345 probably benign Het
Nfasc A T 1: 132,595,591 V887E probably damaging Het
Npsr1 G A 9: 24,313,769 E358K possibly damaging Het
Nrcam T C 12: 44,572,202 L828P possibly damaging Het
Olfr344 T A 2: 36,569,018 L140H probably damaging Het
Oprm1 T C 10: 6,830,234 Y299H probably damaging Het
Osbpl8 T C 10: 111,289,790 V777A possibly damaging Het
Pcnt T C 10: 76,428,014 E372G probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Sbk2 T C 7: 4,957,628 Y181C probably damaging Het
Sf1 G A 19: 6,368,440 probably null Het
Slc26a9 A G 1: 131,767,849 E765G possibly damaging Het
Stab2 A G 10: 86,922,185 L1073P probably damaging Het
Taar3 A G 10: 23,949,859 D101G possibly damaging Het
Thsd4 T C 9: 59,997,222 R204G probably benign Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ttn G A 2: 76,917,770 Q4312* probably null Het
Ubtfl1 T C 9: 18,409,968 V264A probably damaging Het
Vmn1r58 C A 7: 5,410,655 W192L probably damaging Het
Washc5 C A 15: 59,339,862 C969F probably damaging Het
Zdhhc14 A G 17: 5,726,856 K296R probably benign Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp9 G T 6: 118,464,769 P311T probably damaging Het
Other mutations in Sypl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Sypl2 APN 3 108226426 start gained probably benign
R0147:Sypl2 UTSW 3 108219095 missense possibly damaging 0.91
R0148:Sypl2 UTSW 3 108219095 missense possibly damaging 0.91
R0381:Sypl2 UTSW 3 108226157 missense possibly damaging 0.57
R0512:Sypl2 UTSW 3 108226170 missense possibly damaging 0.51
R0751:Sypl2 UTSW 3 108216756 missense probably damaging 0.98
R1279:Sypl2 UTSW 3 108217674 missense probably damaging 1.00
R3411:Sypl2 UTSW 3 108216729 missense possibly damaging 0.94
R4085:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4086:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4089:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4090:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R7063:Sypl2 UTSW 3 108217655 missense probably benign 0.31
R7571:Sypl2 UTSW 3 108214538 makesense probably null
Predicted Primers PCR Primer
(F):5'- CACATAGGCATCAGGACTCAGG -3'
(R):5'- CTACATGACTCCTTTCCCAGGG -3'

Sequencing Primer
(F):5'- GGGAAACTATTACTTTTGATCGCCC -3'
(R):5'- ACTCCTTTCCCAGGGTGAGC -3'
Posted On2015-05-15