Incidental Mutation 'R4088:Vmn1r58'
ID317467
Institutional Source Beutler Lab
Gene Symbol Vmn1r58
Ensembl Gene ENSMUSG00000078808
Gene Namevomeronasal 1 receptor 58
SynonymsV3R4, V1rd4
MMRRC Submission 040981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4088 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5401681-5413396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5410655 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 192 (W192L)
Ref Sequence ENSEMBL: ENSMUSP00000154393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108569] [ENSMUST00000228728]
Predicted Effect probably damaging
Transcript: ENSMUST00000108569
AA Change: W192L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104209
Gene: ENSMUSG00000078808
AA Change: W192L

DomainStartEndE-ValueType
Pfam:TAS2R 1 296 7.8e-13 PFAM
Pfam:7tm_1 20 279 4.4e-7 PFAM
Pfam:V1R 31 296 7.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227549
Predicted Effect probably damaging
Transcript: ENSMUST00000228728
AA Change: W192L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T C 1: 181,227,709 noncoding transcript Het
Alox12b G T 11: 69,158,385 V87L probably benign Het
Arsk T G 13: 76,098,414 N32T probably benign Het
Baz1b T A 5: 135,216,940 N414K probably damaging Het
Cacna1e A T 1: 154,412,183 probably null Het
Cdc73 A G 1: 143,608,514 probably benign Het
Cdhr2 A G 13: 54,717,888 D233G probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Cyp2b9 T C 7: 26,173,456 L8P probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dnajc6 T A 4: 101,639,396 V920E probably damaging Het
Eef2kmt A T 16: 5,253,035 I50N probably damaging Het
Esyt3 T C 9: 99,324,237 M40V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr26 G T 7: 131,967,076 C50F probably benign Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Hsdl2 T A 4: 59,610,636 L211Q unknown Het
Khdrbs2 A G 1: 32,333,524 E93G probably damaging Het
Kif13b T C 14: 64,767,455 probably null Het
Kif15 T A 9: 122,986,189 L423I probably benign Het
Kmt2c A G 5: 25,287,713 V834A probably benign Het
Lama3 T A 18: 12,504,308 Y28* probably null Het
Map4k2 A T 19: 6,353,156 H763L probably damaging Het
Mkl2 T C 16: 13,384,200 F120S probably damaging Het
Ndufs3 C T 2: 90,898,345 probably benign Het
Nfasc A T 1: 132,595,591 V887E probably damaging Het
Npsr1 G A 9: 24,313,769 E358K possibly damaging Het
Nrcam T C 12: 44,572,202 L828P possibly damaging Het
Olfr344 T A 2: 36,569,018 L140H probably damaging Het
Oprm1 T C 10: 6,830,234 Y299H probably damaging Het
Osbpl8 T C 10: 111,289,790 V777A possibly damaging Het
Pcnt T C 10: 76,428,014 E372G probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Sbk2 T C 7: 4,957,628 Y181C probably damaging Het
Sf1 G A 19: 6,368,440 probably null Het
Slc26a9 A G 1: 131,767,849 E765G possibly damaging Het
Stab2 A G 10: 86,922,185 L1073P probably damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar3 A G 10: 23,949,859 D101G possibly damaging Het
Thsd4 T C 9: 59,997,222 R204G probably benign Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ttn G A 2: 76,917,770 Q4312* probably null Het
Ubtfl1 T C 9: 18,409,968 V264A probably damaging Het
Washc5 C A 15: 59,339,862 C969F probably damaging Het
Zdhhc14 A G 17: 5,726,856 K296R probably benign Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp9 G T 6: 118,464,769 P311T probably damaging Het
Other mutations in Vmn1r58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn1r58 APN 7 5411055 missense probably benign 0.19
IGL02792:Vmn1r58 APN 7 5411229 start codon destroyed probably null 0.04
IGL03215:Vmn1r58 APN 7 5410836 missense probably benign 0.00
IGL03259:Vmn1r58 APN 7 5411087 nonsense probably null
K7894:Vmn1r58 UTSW 7 5410703 missense probably benign 0.01
R0033:Vmn1r58 UTSW 7 5410388 missense probably damaging 1.00
R0225:Vmn1r58 UTSW 7 5410866 missense probably benign 0.02
R0304:Vmn1r58 UTSW 7 5410496 missense probably damaging 1.00
R0360:Vmn1r58 UTSW 7 5410330 missense probably benign 0.25
R0363:Vmn1r58 UTSW 7 5410637 missense probably damaging 1.00
R0454:Vmn1r58 UTSW 7 5410998 missense possibly damaging 0.69
R0565:Vmn1r58 UTSW 7 5411166 missense probably benign 0.06
R0612:Vmn1r58 UTSW 7 5410619 missense probably damaging 1.00
R0646:Vmn1r58 UTSW 7 5410677 missense probably benign 0.00
R0853:Vmn1r58 UTSW 7 5410325 missense probably damaging 1.00
R0920:Vmn1r58 UTSW 7 5410789 missense probably benign 0.00
R1696:Vmn1r58 UTSW 7 5410728 missense possibly damaging 0.67
R1823:Vmn1r58 UTSW 7 5410406 missense possibly damaging 0.95
R2326:Vmn1r58 UTSW 7 5410940 missense probably damaging 1.00
R5065:Vmn1r58 UTSW 7 5410835 missense probably benign 0.00
R5087:Vmn1r58 UTSW 7 5410667 missense probably benign 0.04
R5407:Vmn1r58 UTSW 7 5410873 missense probably benign 0.01
R6855:Vmn1r58 UTSW 7 5410452 missense possibly damaging 0.56
R7052:Vmn1r58 UTSW 7 5411135 missense probably benign 0.04
R7334:Vmn1r58 UTSW 7 5411067 missense probably benign 0.04
R7763:Vmn1r58 UTSW 7 5410913 missense probably damaging 1.00
R7840:Vmn1r58 UTSW 7 5411243 start gained probably benign
R7875:Vmn1r58 UTSW 7 5410754 missense probably damaging 0.98
R8004:Vmn1r58 UTSW 7 5410507 nonsense probably null
R8115:Vmn1r58 UTSW 7 5410342 missense probably benign 0.00
R8781:Vmn1r58 UTSW 7 5410483 missense probably benign 0.00
R8802:Vmn1r58 UTSW 7 5411081 missense probably damaging 1.00
X0058:Vmn1r58 UTSW 7 5410395 missense possibly damaging 0.89
Z1176:Vmn1r58 UTSW 7 5410904 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGGCATACCTCAACCAGAG -3'
(R):5'- CCCCAAGGTTGTGAGCTATTG -3'

Sequencing Primer
(F):5'- CCAGAGACGAGATTCCACAAAGG -3'
(R):5'- AGCTATTGTTGTTGCATCTGC -3'
Posted On2015-05-15