Incidental Mutation 'R4088:Cyp2b9'
ID317468
Institutional Source Beutler Lab
Gene Symbol Cyp2b9
Ensembl Gene ENSMUSG00000040660
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms16\alphaoh-a, phenobarbitol inducible, type a, Cyp2b
MMRRC Submission 040981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4088 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26173411-26210661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26173456 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 8 (L8P)
Ref Sequence ENSEMBL: ENSMUSP00000080846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082214]
Predicted Effect probably damaging
Transcript: ENSMUST00000082214
AA Change: L8P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080846
Gene: ENSMUSG00000040660
AA Change: L8P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 1.7e-146 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T C 1: 181,227,709 noncoding transcript Het
Alox12b G T 11: 69,158,385 V87L probably benign Het
Arsk T G 13: 76,098,414 N32T probably benign Het
Baz1b T A 5: 135,216,940 N414K probably damaging Het
Cacna1e A T 1: 154,412,183 probably null Het
Cdc73 A G 1: 143,608,514 probably benign Het
Cdhr2 A G 13: 54,717,888 D233G probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dnajc6 T A 4: 101,639,396 V920E probably damaging Het
Eef2kmt A T 16: 5,253,035 I50N probably damaging Het
Esyt3 T C 9: 99,324,237 M40V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr26 G T 7: 131,967,076 C50F probably benign Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Hsdl2 T A 4: 59,610,636 L211Q unknown Het
Khdrbs2 A G 1: 32,333,524 E93G probably damaging Het
Kif13b T C 14: 64,767,455 probably null Het
Kif15 T A 9: 122,986,189 L423I probably benign Het
Kmt2c A G 5: 25,287,713 V834A probably benign Het
Lama3 T A 18: 12,504,308 Y28* probably null Het
Map4k2 A T 19: 6,353,156 H763L probably damaging Het
Mkl2 T C 16: 13,384,200 F120S probably damaging Het
Ndufs3 C T 2: 90,898,345 probably benign Het
Nfasc A T 1: 132,595,591 V887E probably damaging Het
Npsr1 G A 9: 24,313,769 E358K possibly damaging Het
Nrcam T C 12: 44,572,202 L828P possibly damaging Het
Olfr344 T A 2: 36,569,018 L140H probably damaging Het
Oprm1 T C 10: 6,830,234 Y299H probably damaging Het
Osbpl8 T C 10: 111,289,790 V777A possibly damaging Het
Pcnt T C 10: 76,428,014 E372G probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Sbk2 T C 7: 4,957,628 Y181C probably damaging Het
Sf1 G A 19: 6,368,440 probably null Het
Slc26a9 A G 1: 131,767,849 E765G possibly damaging Het
Stab2 A G 10: 86,922,185 L1073P probably damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar3 A G 10: 23,949,859 D101G possibly damaging Het
Thsd4 T C 9: 59,997,222 R204G probably benign Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ttn G A 2: 76,917,770 Q4312* probably null Het
Ubtfl1 T C 9: 18,409,968 V264A probably damaging Het
Vmn1r58 C A 7: 5,410,655 W192L probably damaging Het
Washc5 C A 15: 59,339,862 C969F probably damaging Het
Zdhhc14 A G 17: 5,726,856 K296R probably benign Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp9 G T 6: 118,464,769 P311T probably damaging Het
Other mutations in Cyp2b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cyp2b9 APN 7 26198505 missense probably damaging 0.99
IGL01133:Cyp2b9 APN 7 26210235 missense probably damaging 1.00
IGL01331:Cyp2b9 APN 7 26187715 missense probably damaging 0.99
IGL02281:Cyp2b9 APN 7 26201104 missense probably damaging 0.99
IGL02502:Cyp2b9 APN 7 26187814 critical splice donor site probably null
IGL02713:Cyp2b9 APN 7 26173520 missense probably benign 0.12
IGL03032:Cyp2b9 APN 7 26198600 splice site probably benign
IGL03307:Cyp2b9 APN 7 26199051 missense probably benign 0.00
R0010:Cyp2b9 UTSW 7 26186753 splice site probably benign
R0025:Cyp2b9 UTSW 7 26200813 missense probably benign 0.09
R0040:Cyp2b9 UTSW 7 26173474 missense possibly damaging 0.68
R0184:Cyp2b9 UTSW 7 26187007 nonsense probably null
R0370:Cyp2b9 UTSW 7 26210106 missense probably damaging 1.00
R1595:Cyp2b9 UTSW 7 26200907 missense possibly damaging 0.72
R1751:Cyp2b9 UTSW 7 26186675 missense probably benign 0.05
R1835:Cyp2b9 UTSW 7 26200783 missense probably benign
R1879:Cyp2b9 UTSW 7 26198569 missense probably damaging 0.99
R2256:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2257:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2418:Cyp2b9 UTSW 7 26186707 missense probably benign 0.00
R3420:Cyp2b9 UTSW 7 26210103 missense probably damaging 1.00
R4412:Cyp2b9 UTSW 7 26198443 missense probably damaging 1.00
R4495:Cyp2b9 UTSW 7 26200755 missense probably benign 0.00
R4615:Cyp2b9 UTSW 7 26201125 missense probably damaging 1.00
R5375:Cyp2b9 UTSW 7 26187742 missense probably damaging 1.00
R5426:Cyp2b9 UTSW 7 26187655 missense probably benign
R5862:Cyp2b9 UTSW 7 26187807 missense probably benign 0.01
R6237:Cyp2b9 UTSW 7 26173574 missense probably benign 0.02
R6445:Cyp2b9 UTSW 7 26186987 missense probably benign 0.13
R6992:Cyp2b9 UTSW 7 26201139 missense probably benign 0.00
R7515:Cyp2b9 UTSW 7 26199171 missense probably damaging 1.00
R7654:Cyp2b9 UTSW 7 26186942 missense possibly damaging 0.72
R7816:Cyp2b9 UTSW 7 26201092 missense probably benign 0.01
R7850:Cyp2b9 UTSW 7 26186686 nonsense probably null
R7933:Cyp2b9 UTSW 7 26186686 nonsense probably null
Z1177:Cyp2b9 UTSW 7 26201163 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGCCCAGGTAGGAACTATGG -3'
(R):5'- CCAACAGCTCCTTCCAATGATTG -3'

Sequencing Primer
(F):5'- GTAGGAACTATGGTGCTCACATTCC -3'
(R):5'- ACAGCTCCTTCCAATGATTGACCTC -3'
Posted On2015-05-15