Mutagenetix > Incidental Mutation

Incidental Mutation 'R4088:Pcnt'

317476

Institutional Source

Beutler Lab

Gene Symbol

Pcnt

Ensembl Gene

ENSMUSG00000001151

Gene Name

pericentrin (kendrin)

Synonyms

m239Asp, m275Asp, Pcnt2

MMRRC Submission

040981-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4088 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76351263-76442786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76428014 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 372 (E372G)

Ref Sequence

ENSEMBL: ENSMUSP00000001179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000001179
AA Change: E372G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: E372G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	78	2.47e-5	PROSPERO
low complexity region	104	114	N/A	INTRINSIC
coiled coil region	131	229	N/A	INTRINSIC
internal_repeat_3	241	259	6.69e-5	PROSPERO
low complexity region	313	325	N/A	INTRINSIC
internal_repeat_3	391	409	6.69e-5	PROSPERO
low complexity region	456	467	N/A	INTRINSIC
coiled coil region	468	520	N/A	INTRINSIC
coiled coil region	554	581	N/A	INTRINSIC
low complexity region	652	666	N/A	INTRINSIC
coiled coil region	727	787	N/A	INTRINSIC
coiled coil region	871	916	N/A	INTRINSIC
low complexity region	931	942	N/A	INTRINSIC
low complexity region	969	985	N/A	INTRINSIC
coiled coil region	1055	1383	N/A	INTRINSIC
coiled coil region	1429	1481	N/A	INTRINSIC
coiled coil region	1529	1567	N/A	INTRINSIC
low complexity region	1614	1624	N/A	INTRINSIC
internal_repeat_2	1916	1964	2.47e-5	PROSPERO
coiled coil region	2158	2178	N/A	INTRINSIC
coiled coil region	2211	2279	N/A	INTRINSIC
coiled coil region	2300	2421	N/A	INTRINSIC
coiled coil region	2447	2526	N/A	INTRINSIC
Pfam:PACT_coil_coil	2718	2797	5.8e-29	PFAM
internal_repeat_1	2820	2885	2.47e-5	PROSPERO
internal_repeat_2	2844	2891	2.47e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000217838
AA Change: E372G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.0858

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

96% (55/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	T	C	1: 181,227,709		noncoding transcript	Het
Alox12b	G	T	11: 69,158,385	V87L	probably benign	Het
Arsk	T	G	13: 76,098,414	N32T	probably benign	Het
Baz1b	T	A	5: 135,216,940	N414K	probably damaging	Het
Cacna1e	A	T	1: 154,412,183		probably null	Het
Cdc73	A	G	1: 143,608,514		probably benign	Het
Cdhr2	A	G	13: 54,717,888	D233G	probably null	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Col4a4	T	A	1: 82,523,922	Y370F	unknown	Het
Cyp2b9	T	C	7: 26,173,456	L8P	probably damaging	Het
Ddx4	A	G	13: 112,613,761	V386A	probably benign	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Dnajc6	T	A	4: 101,639,396	V920E	probably damaging	Het
Eef2kmt	A	T	16: 5,253,035	I50N	probably damaging	Het
Esyt3	T	C	9: 99,324,237	M40V	probably benign	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gpr26	G	T	7: 131,967,076	C50F	probably benign	Het
Hmcn1	A	G	1: 150,703,216	I1993T	possibly damaging	Het
Hsdl2	T	A	4: 59,610,636	L211Q	unknown	Het
Khdrbs2	A	G	1: 32,333,524	E93G	probably damaging	Het
Kif13b	T	C	14: 64,767,455		probably null	Het
Kif15	T	A	9: 122,986,189	L423I	probably benign	Het
Kmt2c	A	G	5: 25,287,713	V834A	probably benign	Het
Lama3	T	A	18: 12,504,308	Y28*	probably null	Het
Map4k2	A	T	19: 6,353,156	H763L	probably damaging	Het
Mkl2	T	C	16: 13,384,200	F120S	probably damaging	Het
Ndufs3	C	T	2: 90,898,345		probably benign	Het
Nfasc	A	T	1: 132,595,591	V887E	probably damaging	Het
Npsr1	G	A	9: 24,313,769	E358K	possibly damaging	Het
Nrcam	T	C	12: 44,572,202	L828P	possibly damaging	Het
Olfr344	T	A	2: 36,569,018	L140H	probably damaging	Het
Oprm1	T	C	10: 6,830,234	Y299H	probably damaging	Het
Osbpl8	T	C	10: 111,289,790	V777A	possibly damaging	Het
Plekhh2	T	C	17: 84,617,999	V1408A	probably benign	Het
Sbk2	T	C	7: 4,957,628	Y181C	probably damaging	Het
Sf1	G	A	19: 6,368,440		probably null	Het
Slc26a9	A	G	1: 131,767,849	E765G	possibly damaging	Het
Stab2	A	G	10: 86,922,185	L1073P	probably damaging	Het
Sypl2	A	G	3: 108,217,676	I123T	possibly damaging	Het
Taar3	A	G	10: 23,949,859	D101G	possibly damaging	Het
Thsd4	T	C	9: 59,997,222	R204G	probably benign	Het
Traf3ip3	A	G	1: 193,181,320	V414A	probably damaging	Het
Trim14	T	A	4: 46,523,709	T110S	probably benign	Het
Trim65	G	A	11: 116,126,479	Q386*	probably null	Het
Ttn	G	A	2: 76,917,770	Q4312*	probably null	Het
Ubtfl1	T	C	9: 18,409,968	V264A	probably damaging	Het
Vmn1r58	C	A	7: 5,410,655	W192L	probably damaging	Het
Washc5	C	A	15: 59,339,862	C969F	probably damaging	Het
Zdhhc14	A	G	17: 5,726,856	K296R	probably benign	Het
Zfp281	T	A	1: 136,626,121	I279N	probably damaging	Het
Zfp9	G	T	6: 118,464,769	P311T	probably damaging	Het

Other mutations in Pcnt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01075:Pcnt	APN	10	76422904	nonsense	probably null
IGL01307:Pcnt	APN	10	76411588	missense	probably damaging	1.00
IGL01549:Pcnt	APN	10	76367486	splice site	probably null
IGL01576:Pcnt	APN	10	76368822	missense	probably damaging	0.99
IGL01611:Pcnt	APN	10	76436424	critical splice donor site	probably null
IGL01630:Pcnt	APN	10	76420246	missense	probably damaging	0.99
IGL01647:Pcnt	APN	10	76370001	nonsense	probably null
IGL01689:Pcnt	APN	10	76411653	missense	probably damaging	1.00
IGL01690:Pcnt	APN	10	76392775	missense	probably damaging	1.00
IGL01723:Pcnt	APN	10	76418499	missense	possibly damaging	0.63
IGL01920:Pcnt	APN	10	76404528	missense	probably damaging	1.00
IGL01958:Pcnt	APN	10	76433679	missense	probably damaging	0.96
IGL02210:Pcnt	APN	10	76389219	missense	possibly damaging	0.95
IGL02225:Pcnt	APN	10	76389474	missense	probably benign	0.00
IGL02228:Pcnt	APN	10	76389474	missense	probably benign	0.00
IGL02237:Pcnt	APN	10	76352984	missense	probably damaging	1.00
IGL02279:Pcnt	APN	10	76403765	missense	probably damaging	1.00
IGL02303:Pcnt	APN	10	76442559	splice site	probably benign
IGL02355:Pcnt	APN	10	76375162	nonsense	probably null
IGL02362:Pcnt	APN	10	76375162	nonsense	probably null
IGL02428:Pcnt	APN	10	76429256	missense	probably damaging	0.99
IGL02536:Pcnt	APN	10	76380229	missense	possibly damaging	0.68
IGL02715:Pcnt	APN	10	76368722	splice site	probably benign
IGL02800:Pcnt	APN	10	76412583	nonsense	probably null
IGL03395:Pcnt	APN	10	76436491	missense	possibly damaging	0.95
IGL02799:Pcnt	UTSW	10	76412583	nonsense	probably null
PIT4520001:Pcnt	UTSW	10	76420235	missense	probably damaging	0.99
R0049:Pcnt	UTSW	10	76369821	unclassified	probably benign
R0049:Pcnt	UTSW	10	76369821	unclassified	probably benign
R0109:Pcnt	UTSW	10	76389196	missense	probably benign	0.00
R0117:Pcnt	UTSW	10	76408727	nonsense	probably null
R0254:Pcnt	UTSW	10	76392580	missense	probably benign	0.10
R0392:Pcnt	UTSW	10	76384826	missense	probably benign
R0511:Pcnt	UTSW	10	76404595	missense	possibly damaging	0.66
R0570:Pcnt	UTSW	10	76412107	missense	probably damaging	1.00
R0614:Pcnt	UTSW	10	76420316	missense	probably damaging	1.00
R0635:Pcnt	UTSW	10	76404585	missense	probably damaging	1.00
R0707:Pcnt	UTSW	10	76420541	missense	probably damaging	1.00
R0749:Pcnt	UTSW	10	76381364	missense	probably damaging	1.00
R0969:Pcnt	UTSW	10	76427951	missense	probably damaging	1.00
R1172:Pcnt	UTSW	10	76393044	splice site	probably null
R1174:Pcnt	UTSW	10	76393044	splice site	probably null
R1175:Pcnt	UTSW	10	76393044	splice site	probably null
R1512:Pcnt	UTSW	10	76404662	splice site	probably null
R1542:Pcnt	UTSW	10	76389387	missense	probably benign	0.08
R1542:Pcnt	UTSW	10	76401386	missense	probably benign	0.02
R1558:Pcnt	UTSW	10	76422922	missense	possibly damaging	0.53
R1562:Pcnt	UTSW	10	76367330	missense	probably benign	0.02
R1762:Pcnt	UTSW	10	76355137	critical splice acceptor site	probably null
R1779:Pcnt	UTSW	10	76408796	missense	probably damaging	0.99
R1869:Pcnt	UTSW	10	76379906	missense	probably null	0.94
R1911:Pcnt	UTSW	10	76368816	missense	possibly damaging	0.94
R1985:Pcnt	UTSW	10	76380337	missense	possibly damaging	0.95
R1995:Pcnt	UTSW	10	76392799	nonsense	probably null
R2073:Pcnt	UTSW	10	76380380	missense	possibly damaging	0.92
R2111:Pcnt	UTSW	10	76420526	missense	probably damaging	0.99
R2112:Pcnt	UTSW	10	76420526	missense	probably damaging	0.99
R2309:Pcnt	UTSW	10	76442626	start gained	probably benign
R2902:Pcnt	UTSW	10	76375230	missense	probably damaging	0.98
R3623:Pcnt	UTSW	10	76433750	missense	probably benign	0.23
R4300:Pcnt	UTSW	10	76367391	missense	probably benign	0.40
R4402:Pcnt	UTSW	10	76392393	missense	probably benign	0.00
R4407:Pcnt	UTSW	10	76374870	missense	possibly damaging	0.90
R4483:Pcnt	UTSW	10	76401483	missense	probably damaging	1.00
R4647:Pcnt	UTSW	10	76354213	missense	probably benign	0.01
R4734:Pcnt	UTSW	10	76437206	missense	probably benign	0.25
R4747:Pcnt	UTSW	10	76436465	missense	possibly damaging	0.91
R4782:Pcnt	UTSW	10	76409577	missense	possibly damaging	0.62
R4795:Pcnt	UTSW	10	76370024	missense	probably benign	0.21
R4831:Pcnt	UTSW	10	76412501	missense	probably damaging	0.96
R4873:Pcnt	UTSW	10	76369854	missense	probably benign	0.03
R4875:Pcnt	UTSW	10	76369854	missense	probably benign	0.03
R4946:Pcnt	UTSW	10	76356185	missense	probably damaging	1.00
R5032:Pcnt	UTSW	10	76355077	missense	probably benign	0.00
R5033:Pcnt	UTSW	10	76399945	missense	possibly damaging	0.95
R5106:Pcnt	UTSW	10	76401444	missense	probably damaging	1.00
R5118:Pcnt	UTSW	10	76412168	missense	probably damaging	0.98
R5167:Pcnt	UTSW	10	76420424	missense	probably damaging	0.97
R5199:Pcnt	UTSW	10	76418544	missense	probably benign	0.09
R5223:Pcnt	UTSW	10	76380272	missense	probably damaging	0.99
R5241:Pcnt	UTSW	10	76433617	missense	probably benign	0.26
R5308:Pcnt	UTSW	10	76356325	nonsense	probably null
R5328:Pcnt	UTSW	10	76411719	missense	probably damaging	1.00
R5454:Pcnt	UTSW	10	76389547	splice site	probably null
R5543:Pcnt	UTSW	10	76412052	missense	probably benign	0.01
R5588:Pcnt	UTSW	10	76442611	missense	possibly damaging	0.74
R5647:Pcnt	UTSW	10	76385841	missense	probably benign	0.17
R5668:Pcnt	UTSW	10	76409500	missense	probably benign	0.16
R5712:Pcnt	UTSW	10	76429271	missense	probably damaging	0.96
R5714:Pcnt	UTSW	10	76420491	missense	probably damaging	1.00
R5797:Pcnt	UTSW	10	76392756	missense	probably benign	0.00
R5946:Pcnt	UTSW	10	76382063	missense	possibly damaging	0.91
R5955:Pcnt	UTSW	10	76411622	missense	possibly damaging	0.45
R6024:Pcnt	UTSW	10	76420037	missense	possibly damaging	0.87
R6267:Pcnt	UTSW	10	76385798	missense	probably benign	0.02
R6485:Pcnt	UTSW	10	76389330	nonsense	probably null
R6605:Pcnt	UTSW	10	76429198	critical splice donor site	probably null
R6877:Pcnt	UTSW	10	76434017	missense	possibly damaging	0.94
R6882:Pcnt	UTSW	10	76427828	missense	probably benign	0.00
R6919:Pcnt	UTSW	10	76385798	missense	probably benign	0.02
R7025:Pcnt	UTSW	10	76403835	missense	probably damaging	1.00
R7098:Pcnt	UTSW	10	76384839	missense	probably benign
R7109:Pcnt	UTSW	10	76369904	missense	probably damaging	1.00
R7121:Pcnt	UTSW	10	76427927	missense	possibly damaging	0.73
R7143:Pcnt	UTSW	10	76389060	missense	possibly damaging	0.47
R7152:Pcnt	UTSW	10	76411360	splice site	probably null
R7213:Pcnt	UTSW	10	76408904	missense	probably damaging	1.00
R7368:Pcnt	UTSW	10	76400001	missense	probably benign
R7453:Pcnt	UTSW	10	76389450	missense	probably benign
R7486:Pcnt	UTSW	10	76418436	missense	probably benign	0.03
R7486:Pcnt	UTSW	10	76418437	missense	probably benign
R7538:Pcnt	UTSW	10	76399939	missense	probably benign
R7575:Pcnt	UTSW	10	76389252	missense	probably benign	0.32
R7662:Pcnt	UTSW	10	76387522	missense	probably benign	0.27
R7685:Pcnt	UTSW	10	76422808	missense	probably benign	0.14
R7764:Pcnt	UTSW	10	76354248	missense	probably benign	0.33
R7802:Pcnt	UTSW	10	76375303	splice site	probably null
R8432:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8439:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8493:Pcnt	UTSW	10	76403623	critical splice donor site	probably null
R8530:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8535:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8830:Pcnt	UTSW	10	76382174	missense	probably benign	0.03
R8878:Pcnt	UTSW	10	76408841	missense	probably damaging	1.00
R8911:Pcnt	UTSW	10	76387525	missense	probably damaging	0.98
R8988:Pcnt	UTSW	10	76409573	nonsense	probably null
R9084:Pcnt	UTSW	10	76399992	missense	probably benign	0.09
R9169:Pcnt	UTSW	10	76385738	missense	possibly damaging	0.95
R9372:Pcnt	UTSW	10	76423126	missense	probably damaging	1.00
R9411:Pcnt	UTSW	10	76423062	missense	probably damaging	0.96
R9448:Pcnt	UTSW	10	76420526	missense	probably damaging	0.99
R9459:Pcnt	UTSW	10	76392738	missense	probably damaging	1.00
R9479:Pcnt	UTSW	10	76382129	missense	probably benign	0.00
R9503:Pcnt	UTSW	10	76428048	missense	possibly damaging	0.59
R9561:Pcnt	UTSW	10	76381294	nonsense	probably null
R9618:Pcnt	UTSW	10	76352960	missense	probably damaging	1.00
R9648:Pcnt	UTSW	10	76354255	missense	probably benign	0.32
R9733:Pcnt	UTSW	10	76401480	missense	probably benign	0.01
Z1176:Pcnt	UTSW	10	76382157	nonsense	probably null
Z1177:Pcnt	UTSW	10	76399968	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACTCCAGAGAATCCTCCCTTG -3'
(R):5'- CATGACTTCAGGGCCAGTTCTC -3'

Sequencing Primer
(F):5'- AGAGAATCCTCCCTTGCCTCC -3'
(R):5'- AGTTCTCCCACCTGCCACAG -3'

Posted On

2015-05-15