Incidental Mutation 'R4088:Ddx4'
ID317482
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 4
SynonymsMvh, VASA, mvh / m'vasa
MMRRC Submission 040981-MU
Accession Numbers

Genbank: NM_001145885, NM_010029

Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R4088 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112598333-112652475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112613761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 386 (V386A)
Ref Sequence ENSEMBL: ENSMUSP00000075157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
Predicted Effect probably benign
Transcript: ENSMUST00000075748
AA Change: V386A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: V386A

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099166
AA Change: V412A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: V412A

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T C 1: 181,227,709 noncoding transcript Het
Alox12b G T 11: 69,158,385 V87L probably benign Het
Arsk T G 13: 76,098,414 N32T probably benign Het
Baz1b T A 5: 135,216,940 N414K probably damaging Het
Cacna1e A T 1: 154,412,183 probably null Het
Cdc73 A G 1: 143,608,514 probably benign Het
Cdhr2 A G 13: 54,717,888 D233G probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Cyp2b9 T C 7: 26,173,456 L8P probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dnajc6 T A 4: 101,639,396 V920E probably damaging Het
Eef2kmt A T 16: 5,253,035 I50N probably damaging Het
Esyt3 T C 9: 99,324,237 M40V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr26 G T 7: 131,967,076 C50F probably benign Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Hsdl2 T A 4: 59,610,636 L211Q unknown Het
Khdrbs2 A G 1: 32,333,524 E93G probably damaging Het
Kif13b T C 14: 64,767,455 probably null Het
Kif15 T A 9: 122,986,189 L423I probably benign Het
Kmt2c A G 5: 25,287,713 V834A probably benign Het
Lama3 T A 18: 12,504,308 Y28* probably null Het
Map4k2 A T 19: 6,353,156 H763L probably damaging Het
Mkl2 T C 16: 13,384,200 F120S probably damaging Het
Ndufs3 C T 2: 90,898,345 probably benign Het
Nfasc A T 1: 132,595,591 V887E probably damaging Het
Npsr1 G A 9: 24,313,769 E358K possibly damaging Het
Nrcam T C 12: 44,572,202 L828P possibly damaging Het
Olfr344 T A 2: 36,569,018 L140H probably damaging Het
Oprm1 T C 10: 6,830,234 Y299H probably damaging Het
Osbpl8 T C 10: 111,289,790 V777A possibly damaging Het
Pcnt T C 10: 76,428,014 E372G probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Sbk2 T C 7: 4,957,628 Y181C probably damaging Het
Sf1 G A 19: 6,368,440 probably null Het
Slc26a9 A G 1: 131,767,849 E765G possibly damaging Het
Stab2 A G 10: 86,922,185 L1073P probably damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar3 A G 10: 23,949,859 D101G possibly damaging Het
Thsd4 T C 9: 59,997,222 R204G probably benign Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ttn G A 2: 76,917,770 Q4312* probably null Het
Ubtfl1 T C 9: 18,409,968 V264A probably damaging Het
Vmn1r58 C A 7: 5,410,655 W192L probably damaging Het
Washc5 C A 15: 59,339,862 C969F probably damaging Het
Zdhhc14 A G 17: 5,726,856 K296R probably benign Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp9 G T 6: 118,464,769 P311T probably damaging Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112624777 splice site probably benign
IGL02682:Ddx4 APN 13 112622186 missense probably benign 0.04
IGL02729:Ddx4 APN 13 112651412 utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112613833 splice site probably null
R0518:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R0521:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R1527:Ddx4 UTSW 13 112622239 missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112599997 missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112599902 missense probably benign
R1886:Ddx4 UTSW 13 112622665 missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112620742 missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R2265:Ddx4 UTSW 13 112621276 missense probably benign 0.08
R2280:Ddx4 UTSW 13 112620656 missense probably benign 0.03
R2846:Ddx4 UTSW 13 112604612 missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112620777 splice site probably benign
R2980:Ddx4 UTSW 13 112612085 missense probably damaging 1.00
R3732:Ddx4 UTSW 13 112611982 missense possibly damaging 0.56
R4085:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4089:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4090:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4600:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4610:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112622244 missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112613696 critical splice donor site probably null
R4782:Ddx4 UTSW 13 112651360 missense probably benign 0.10
R5326:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R5542:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112621232 nonsense probably null
R6253:Ddx4 UTSW 13 112636022 nonsense probably null
R6253:Ddx4 UTSW 13 112636023 missense probably benign 0.00
R6286:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112604547 missense probably benign
R6645:Ddx4 UTSW 13 112641174 missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112601488 missense probably damaging 1.00
R7155:Ddx4 UTSW 13 112613785 missense probably benign 0.01
R7822:Ddx4 UTSW 13 112612113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCGTTTTGTTTCCACAAG -3'
(R):5'- GCAAACAGGTTGAGTCTTGTCC -3'

Sequencing Primer
(F):5'- GGAAAATGCTATTATCCTGTGCG -3'
(R):5'- GTGTAAGAGCTGTGGTCAT -3'
Posted On2015-05-15