Mutagenetix > Incidental Mutations

Incidental Mutation 'R4088:Kif13b'

317483

Institutional Source

Beutler Lab

Gene Symbol

Kif13b

Ensembl Gene

ENSMUSG00000060012

Gene Name

kinesin family member 13B

Synonyms

N-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN

MMRRC Submission

040981-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4088 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64647265-64809617 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 64767455 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]

Predicted Effect

probably null
Transcript: ENSMUST00000100473

SMART Domains

Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012

Domain	Start	End	E-Value	Type
KISc	3	361	1.4e-182	SMART
FHA	470	520	6.86e-1	SMART
low complexity region	546	560	N/A	INTRINSIC
coiled coil region	617	646	N/A	INTRINSIC
coiled coil region	669	701	N/A	INTRINSIC
Pfam:KIF1B	756	802	4.1e-20	PFAM
Pfam:DUF3694	1003	1279	1.4e-37	PFAM
low complexity region	1514	1526	N/A	INTRINSIC
low complexity region	1532	1548	N/A	INTRINSIC
low complexity region	1574	1589	N/A	INTRINSIC
low complexity region	1617	1630	N/A	INTRINSIC
CAP_GLY	1719	1784	1.54e-29	SMART
low complexity region	1814	1826	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000224503

Meta Mutation Damage Score

0.9498

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

96% (55/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	T	C	1: 181,227,709		noncoding transcript	Het
Alox12b	G	T	11: 69,158,385	V87L	probably benign	Het
Arsk	T	G	13: 76,098,414	N32T	probably benign	Het
Baz1b	T	A	5: 135,216,940	N414K	probably damaging	Het
Cacna1e	A	T	1: 154,412,183		probably null	Het
Cdc73	A	G	1: 143,608,514		probably benign	Het
Cdhr2	A	G	13: 54,717,888	D233G	probably null	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Col4a4	T	A	1: 82,523,922	Y370F	unknown	Het
Cyp2b9	T	C	7: 26,173,456	L8P	probably damaging	Het
Ddx4	A	G	13: 112,613,761	V386A	probably benign	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Dnajc6	T	A	4: 101,639,396	V920E	probably damaging	Het
Eef2kmt	A	T	16: 5,253,035	I50N	probably damaging	Het
Esyt3	T	C	9: 99,324,237	M40V	probably benign	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gpr26	G	T	7: 131,967,076	C50F	probably benign	Het
Hmcn1	A	G	1: 150,703,216	I1993T	possibly damaging	Het
Hsdl2	T	A	4: 59,610,636	L211Q	unknown	Het
Khdrbs2	A	G	1: 32,333,524	E93G	probably damaging	Het
Kif15	T	A	9: 122,986,189	L423I	probably benign	Het
Kmt2c	A	G	5: 25,287,713	V834A	probably benign	Het
Lama3	T	A	18: 12,504,308	Y28*	probably null	Het
Map4k2	A	T	19: 6,353,156	H763L	probably damaging	Het
Mkl2	T	C	16: 13,384,200	F120S	probably damaging	Het
Ndufs3	C	T	2: 90,898,345		probably benign	Het
Nfasc	A	T	1: 132,595,591	V887E	probably damaging	Het
Npsr1	G	A	9: 24,313,769	E358K	possibly damaging	Het
Nrcam	T	C	12: 44,572,202	L828P	possibly damaging	Het
Olfr344	T	A	2: 36,569,018	L140H	probably damaging	Het
Oprm1	T	C	10: 6,830,234	Y299H	probably damaging	Het
Osbpl8	T	C	10: 111,289,790	V777A	possibly damaging	Het
Pcnt	T	C	10: 76,428,014	E372G	probably damaging	Het
Plekhh2	T	C	17: 84,617,999	V1408A	probably benign	Het
Sbk2	T	C	7: 4,957,628	Y181C	probably damaging	Het
Sf1	G	A	19: 6,368,440		probably null	Het
Slc26a9	A	G	1: 131,767,849	E765G	possibly damaging	Het
Stab2	A	G	10: 86,922,185	L1073P	probably damaging	Het
Sypl2	A	G	3: 108,217,676	I123T	possibly damaging	Het
Taar3	A	G	10: 23,949,859	D101G	possibly damaging	Het
Thsd4	T	C	9: 59,997,222	R204G	probably benign	Het
Traf3ip3	A	G	1: 193,181,320	V414A	probably damaging	Het
Trim14	T	A	4: 46,523,709	T110S	probably benign	Het
Trim65	G	A	11: 116,126,479	Q386*	probably null	Het
Ttn	G	A	2: 76,917,770	Q4312*	probably null	Het
Ubtfl1	T	C	9: 18,409,968	V264A	probably damaging	Het
Vmn1r58	C	A	7: 5,410,655	W192L	probably damaging	Het
Washc5	C	A	15: 59,339,862	C969F	probably damaging	Het
Zdhhc14	A	G	17: 5,726,856	K296R	probably benign	Het
Zfp281	T	A	1: 136,626,121	I279N	probably damaging	Het
Zfp9	G	T	6: 118,464,769	P311T	probably damaging	Het

Other mutations in Kif13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Kif13b	APN	14	64669693	missense	possibly damaging	0.81
IGL00485:Kif13b	APN	14	64765073	missense	possibly damaging	0.88
IGL00495:Kif13b	APN	14	64714113	missense	probably benign	0.07
IGL00556:Kif13b	APN	14	64744888	missense	probably damaging	1.00
IGL00571:Kif13b	APN	14	64746417	missense	probably damaging	0.99
IGL00590:Kif13b	APN	14	64779462	missense	probably damaging	1.00
IGL01650:Kif13b	APN	14	64765145	missense	probably benign	0.00
IGL01730:Kif13b	APN	14	64750361	critical splice donor site	probably null
IGL01908:Kif13b	APN	14	64757558	missense	probably damaging	1.00
IGL02388:Kif13b	APN	14	64800358	missense	probably damaging	1.00
IGL02573:Kif13b	APN	14	64803431	missense	probably damaging	1.00
IGL02661:Kif13b	APN	14	64767691	missense	probably benign	0.06
IGL02794:Kif13b	APN	14	64803440	missense	probably benign	0.00
IGL02959:Kif13b	APN	14	64767717	missense	probably damaging	1.00
IGL02979:Kif13b	APN	14	64789697	missense	probably damaging	0.96
IGL03114:Kif13b	APN	14	64788448	missense	probably benign	0.00
R0024:Kif13b	UTSW	14	64750273	missense	probably benign	0.30
R0330:Kif13b	UTSW	14	64803220	missense	probably benign
R0376:Kif13b	UTSW	14	64757404	splice site	probably benign
R0571:Kif13b	UTSW	14	64751528	missense	probably damaging	1.00
R0718:Kif13b	UTSW	14	64751662	splice site	probably benign
R1144:Kif13b	UTSW	14	64714117	missense	probably benign	0.01
R1183:Kif13b	UTSW	14	64782377	missense	probably benign	0.00
R1264:Kif13b	UTSW	14	64776232	splice site	probably benign
R1497:Kif13b	UTSW	14	64736266	missense	probably damaging	0.99
R1579:Kif13b	UTSW	14	64782341	critical splice acceptor site	probably null
R1624:Kif13b	UTSW	14	64738619	missense	probably damaging	0.99
R1706:Kif13b	UTSW	14	64760666	splice site	probably benign
R2176:Kif13b	UTSW	14	64669671	missense	probably benign	0.01
R3727:Kif13b	UTSW	14	64765748	splice site	probably benign
R3785:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R3786:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R4279:Kif13b	UTSW	14	64779356	missense	probably damaging	1.00
R4559:Kif13b	UTSW	14	64806132	missense	probably damaging	0.98
R4689:Kif13b	UTSW	14	64773064	missense	probably damaging	1.00
R4692:Kif13b	UTSW	14	64803575	missense	probably benign	0.05
R4878:Kif13b	UTSW	14	64806154	missense	probably benign	0.00
R4971:Kif13b	UTSW	14	64757562	missense	possibly damaging	0.90
R5037:Kif13b	UTSW	14	64758589	nonsense	probably null
R5119:Kif13b	UTSW	14	64757453	missense	probably benign	0.01
R5167:Kif13b	UTSW	14	64772935	missense	probably damaging	1.00
R5408:Kif13b	UTSW	14	64779689	critical splice acceptor site	probably null
R5437:Kif13b	UTSW	14	64806114	missense	probably damaging	0.99
R5756:Kif13b	UTSW	14	64736305	missense	probably damaging	1.00
R5838:Kif13b	UTSW	14	64737555	missense	probably damaging	1.00
R5891:Kif13b	UTSW	14	64788405	splice site	probably null
R6120:Kif13b	UTSW	14	64751558	missense	probably damaging	1.00
R6150:Kif13b	UTSW	14	64751639	missense	probably damaging	0.99
R6165:Kif13b	UTSW	14	64742311	missense	probably damaging	1.00
R6187:Kif13b	UTSW	14	64736215	missense	probably damaging	1.00
R6229:Kif13b	UTSW	14	64738567	missense	probably damaging	1.00
R6267:Kif13b	UTSW	14	64738634	missense	probably damaging	1.00
R6347:Kif13b	UTSW	14	64767619	missense	probably benign	0.26
R6479:Kif13b	UTSW	14	64751525	missense	probably benign	0.08
R6512:Kif13b	UTSW	14	64744874	critical splice acceptor site	probably null
R6851:Kif13b	UTSW	14	64773065	missense	probably damaging	1.00
R7131:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7217:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7398:Kif13b	UTSW	14	64757523	missense	probably null	0.02
R7427:Kif13b	UTSW	14	64788460	missense	probably benign
R7428:Kif13b	UTSW	14	64788460	missense	probably benign
R7573:Kif13b	UTSW	14	64803658	missense	probably benign	0.00
R7629:Kif13b	UTSW	14	64779335	nonsense	probably null
R7683:Kif13b	UTSW	14	64757507	missense	probably benign	0.24
R7835:Kif13b	UTSW	14	64767452	missense	probably benign	0.00
R7895:Kif13b	UTSW	14	64736149	missense	probably damaging	1.00
R8285:Kif13b	UTSW	14	64782376	missense	probably benign	0.03
R8374:Kif13b	UTSW	14	64788435	missense	probably damaging	0.97
R8467:Kif13b	UTSW	14	64758705
Z1176:Kif13b	UTSW	14	64803344	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAAATAGTTGTTGCGTGCTGC -3'
(R):5'- TCGGTCAGCATCATCCTCAG -3'

Sequencing Primer
(F):5'- CAAAGTTAATTTGGGGAGTGTCTAG -3'
(R):5'- CCTCAGTTTTGTCTAGAAGAGCAGAG -3'

Posted On

2015-05-15