Incidental Mutation 'R4088:Mkl2'
ID317486
Institutional Source Beutler Lab
Gene Symbol Mkl2
Ensembl Gene ENSMUSG00000009569
Gene NameMKL/myocardin-like 2
SynonymsGt4-1, MRTF-B, Mrtfb
MMRRC Submission 040981-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4088 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13256481-13417529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13384200 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 120 (F120S)
Ref Sequence ENSEMBL: ENSMUSP00000009713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]
Predicted Effect probably damaging
Transcript: ENSMUST00000009713
AA Change: F120S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: F120S

DomainStartEndE-ValueType
RPEL 51 76 9.67e-5 SMART
RPEL 95 120 2.22e-4 SMART
RPEL 139 164 1.56e-8 SMART
low complexity region 217 230 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 329 352 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
SAP 394 428 1.29e-8 SMART
low complexity region 495 510 N/A INTRINSIC
coiled coil region 552 601 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
low complexity region 699 722 N/A INTRINSIC
low complexity region 749 775 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1057 1074 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140892
Predicted Effect probably benign
Transcript: ENSMUST00000149359
AA Change: F109S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: F109S

DomainStartEndE-ValueType
RPEL 40 65 4.51e-5 SMART
RPEL 84 109 2.22e-4 SMART
RPEL 128 153 1.56e-8 SMART
low complexity region 206 219 N/A INTRINSIC
low complexity region 280 293 N/A INTRINSIC
low complexity region 318 341 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
SAP 383 417 1.29e-8 SMART
low complexity region 484 499 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 688 711 N/A INTRINSIC
low complexity region 738 764 N/A INTRINSIC
low complexity region 831 843 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210378
Meta Mutation Damage Score 0.0888 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T C 1: 181,227,709 noncoding transcript Het
Alox12b G T 11: 69,158,385 V87L probably benign Het
Arsk T G 13: 76,098,414 N32T probably benign Het
Baz1b T A 5: 135,216,940 N414K probably damaging Het
Cacna1e A T 1: 154,412,183 probably null Het
Cdc73 A G 1: 143,608,514 probably benign Het
Cdhr2 A G 13: 54,717,888 D233G probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Cyp2b9 T C 7: 26,173,456 L8P probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dnajc6 T A 4: 101,639,396 V920E probably damaging Het
Eef2kmt A T 16: 5,253,035 I50N probably damaging Het
Esyt3 T C 9: 99,324,237 M40V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr26 G T 7: 131,967,076 C50F probably benign Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Hsdl2 T A 4: 59,610,636 L211Q unknown Het
Khdrbs2 A G 1: 32,333,524 E93G probably damaging Het
Kif13b T C 14: 64,767,455 probably null Het
Kif15 T A 9: 122,986,189 L423I probably benign Het
Kmt2c A G 5: 25,287,713 V834A probably benign Het
Lama3 T A 18: 12,504,308 Y28* probably null Het
Map4k2 A T 19: 6,353,156 H763L probably damaging Het
Ndufs3 C T 2: 90,898,345 probably benign Het
Nfasc A T 1: 132,595,591 V887E probably damaging Het
Npsr1 G A 9: 24,313,769 E358K possibly damaging Het
Nrcam T C 12: 44,572,202 L828P possibly damaging Het
Olfr344 T A 2: 36,569,018 L140H probably damaging Het
Oprm1 T C 10: 6,830,234 Y299H probably damaging Het
Osbpl8 T C 10: 111,289,790 V777A possibly damaging Het
Pcnt T C 10: 76,428,014 E372G probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Sbk2 T C 7: 4,957,628 Y181C probably damaging Het
Sf1 G A 19: 6,368,440 probably null Het
Slc26a9 A G 1: 131,767,849 E765G possibly damaging Het
Stab2 A G 10: 86,922,185 L1073P probably damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar3 A G 10: 23,949,859 D101G possibly damaging Het
Thsd4 T C 9: 59,997,222 R204G probably benign Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ttn G A 2: 76,917,770 Q4312* probably null Het
Ubtfl1 T C 9: 18,409,968 V264A probably damaging Het
Vmn1r58 C A 7: 5,410,655 W192L probably damaging Het
Washc5 C A 15: 59,339,862 C969F probably damaging Het
Zdhhc14 A G 17: 5,726,856 K296R probably benign Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp9 G T 6: 118,464,769 P311T probably damaging Het
Other mutations in Mkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Mkl2 APN 16 13403222 missense probably benign 0.28
IGL00546:Mkl2 APN 16 13403225 missense possibly damaging 0.71
IGL01325:Mkl2 APN 16 13401224 missense probably damaging 1.00
IGL02125:Mkl2 APN 16 13400183 splice site probably null
IGL02803:Mkl2 APN 16 13403156 missense possibly damaging 0.94
IGL03143:Mkl2 APN 16 13400812 missense possibly damaging 0.46
IGL03180:Mkl2 APN 16 13398332 missense probably damaging 1.00
R0281:Mkl2 UTSW 16 13412163 missense probably damaging 0.99
R0505:Mkl2 UTSW 16 13412526 missense possibly damaging 0.80
R0540:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R0607:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R1073:Mkl2 UTSW 16 13412318 missense possibly damaging 0.89
R1423:Mkl2 UTSW 16 13412241 missense possibly damaging 0.96
R1432:Mkl2 UTSW 16 13401002 missense probably benign 0.01
R1459:Mkl2 UTSW 16 13401569 missense possibly damaging 0.93
R1693:Mkl2 UTSW 16 13398470 missense possibly damaging 0.67
R1693:Mkl2 UTSW 16 13398471 missense probably damaging 0.99
R2006:Mkl2 UTSW 16 13381576 nonsense probably null
R2076:Mkl2 UTSW 16 13401382 missense probably benign 0.01
R2125:Mkl2 UTSW 16 13400804 missense possibly damaging 0.94
R2145:Mkl2 UTSW 16 13412586 missense probably damaging 0.98
R3722:Mkl2 UTSW 16 13385693 missense probably damaging 1.00
R3883:Mkl2 UTSW 16 13401458 missense probably damaging 0.99
R4204:Mkl2 UTSW 16 13403255 missense possibly damaging 0.88
R4301:Mkl2 UTSW 16 13398305 missense probably damaging 1.00
R4622:Mkl2 UTSW 16 13332706 missense probably damaging 1.00
R4633:Mkl2 UTSW 16 13379873 missense possibly damaging 0.95
R4765:Mkl2 UTSW 16 13412594 missense probably damaging 1.00
R5201:Mkl2 UTSW 16 13401592 missense probably benign 0.00
R5403:Mkl2 UTSW 16 13401013 missense probably damaging 0.97
R5725:Mkl2 UTSW 16 13384310 nonsense probably null
R6511:Mkl2 UTSW 16 13379850 missense probably damaging 1.00
R7207:Mkl2 UTSW 16 13326436 missense probably benign
R7269:Mkl2 UTSW 16 13401034 missense possibly damaging 0.48
R7311:Mkl2 UTSW 16 13405854 nonsense probably null
R7460:Mkl2 UTSW 16 13400976 missense probably benign 0.00
Z1177:Mkl2 UTSW 16 13385606 missense not run
Predicted Primers PCR Primer
(F):5'- GCAGTTCCCATTGCAGCTTC -3'
(R):5'- TGACGTTAGCATCTTAGTCAGATC -3'

Sequencing Primer
(F):5'- CATTGCAGCTTCAGTTCATGG -3'
(R):5'- TTTCTCCCAGAAGACTGAGGCTAG -3'
Posted On2015-05-15