Mutagenetix > Incidental Mutations

Incidental Mutation 'R4088:Mkl2'

317486

Institutional Source

Beutler Lab

Gene Symbol

Mkl2

Ensembl Gene

ENSMUSG00000009569

Gene Name

MKL/myocardin-like 2

Synonyms

Gt4-1, MRTF-B, Mrtfb

MMRRC Submission

040981-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4088 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13256481-13417529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13384200 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 120 (F120S)

Ref Sequence

ENSEMBL: ENSMUSP00000009713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]

Predicted Effect

probably damaging
Transcript: ENSMUST00000009713
AA Change: F120S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: F120S

Domain	Start	End	E-Value	Type
RPEL	51	76	9.67e-5	SMART
RPEL	95	120	2.22e-4	SMART
RPEL	139	164	1.56e-8	SMART
low complexity region	217	230	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	329	352	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
SAP	394	428	1.29e-8	SMART
low complexity region	495	510	N/A	INTRINSIC
coiled coil region	552	601	N/A	INTRINSIC
low complexity region	603	617	N/A	INTRINSIC
low complexity region	699	722	N/A	INTRINSIC
low complexity region	749	775	N/A	INTRINSIC
low complexity region	842	854	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1057	1074	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140892

Predicted Effect

probably benign
Transcript: ENSMUST00000149359
AA Change: F109S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: F109S

Domain	Start	End	E-Value	Type
RPEL	40	65	4.51e-5	SMART
RPEL	84	109	2.22e-4	SMART
RPEL	128	153	1.56e-8	SMART
low complexity region	206	219	N/A	INTRINSIC
low complexity region	280	293	N/A	INTRINSIC
low complexity region	318	341	N/A	INTRINSIC
low complexity region	358	370	N/A	INTRINSIC
SAP	383	417	1.29e-8	SMART
low complexity region	484	499	N/A	INTRINSIC
coiled coil region	541	590	N/A	INTRINSIC
low complexity region	592	606	N/A	INTRINSIC
low complexity region	688	711	N/A	INTRINSIC
low complexity region	738	764	N/A	INTRINSIC
low complexity region	831	843	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1046	1063	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210378

Meta Mutation Damage Score

0.0888

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

96% (55/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	T	C	1: 181,227,709		noncoding transcript	Het
Alox12b	G	T	11: 69,158,385	V87L	probably benign	Het
Arsk	T	G	13: 76,098,414	N32T	probably benign	Het
Baz1b	T	A	5: 135,216,940	N414K	probably damaging	Het
Cacna1e	A	T	1: 154,412,183		probably null	Het
Cdc73	A	G	1: 143,608,514		probably benign	Het
Cdhr2	A	G	13: 54,717,888	D233G	probably null	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Col4a4	T	A	1: 82,523,922	Y370F	unknown	Het
Cyp2b9	T	C	7: 26,173,456	L8P	probably damaging	Het
Ddx4	A	G	13: 112,613,761	V386A	probably benign	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Dnajc6	T	A	4: 101,639,396	V920E	probably damaging	Het
Eef2kmt	A	T	16: 5,253,035	I50N	probably damaging	Het
Esyt3	T	C	9: 99,324,237	M40V	probably benign	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gpr26	G	T	7: 131,967,076	C50F	probably benign	Het
Hmcn1	A	G	1: 150,703,216	I1993T	possibly damaging	Het
Hsdl2	T	A	4: 59,610,636	L211Q	unknown	Het
Khdrbs2	A	G	1: 32,333,524	E93G	probably damaging	Het
Kif13b	T	C	14: 64,767,455		probably null	Het
Kif15	T	A	9: 122,986,189	L423I	probably benign	Het
Kmt2c	A	G	5: 25,287,713	V834A	probably benign	Het
Lama3	T	A	18: 12,504,308	Y28*	probably null	Het
Map4k2	A	T	19: 6,353,156	H763L	probably damaging	Het
Ndufs3	C	T	2: 90,898,345		probably benign	Het
Nfasc	A	T	1: 132,595,591	V887E	probably damaging	Het
Npsr1	G	A	9: 24,313,769	E358K	possibly damaging	Het
Nrcam	T	C	12: 44,572,202	L828P	possibly damaging	Het
Olfr344	T	A	2: 36,569,018	L140H	probably damaging	Het
Oprm1	T	C	10: 6,830,234	Y299H	probably damaging	Het
Osbpl8	T	C	10: 111,289,790	V777A	possibly damaging	Het
Pcnt	T	C	10: 76,428,014	E372G	probably damaging	Het
Plekhh2	T	C	17: 84,617,999	V1408A	probably benign	Het
Sbk2	T	C	7: 4,957,628	Y181C	probably damaging	Het
Sf1	G	A	19: 6,368,440		probably null	Het
Slc26a9	A	G	1: 131,767,849	E765G	possibly damaging	Het
Stab2	A	G	10: 86,922,185	L1073P	probably damaging	Het
Sypl2	A	G	3: 108,217,676	I123T	possibly damaging	Het
Taar3	A	G	10: 23,949,859	D101G	possibly damaging	Het
Thsd4	T	C	9: 59,997,222	R204G	probably benign	Het
Traf3ip3	A	G	1: 193,181,320	V414A	probably damaging	Het
Trim14	T	A	4: 46,523,709	T110S	probably benign	Het
Trim65	G	A	11: 116,126,479	Q386*	probably null	Het
Ttn	G	A	2: 76,917,770	Q4312*	probably null	Het
Ubtfl1	T	C	9: 18,409,968	V264A	probably damaging	Het
Vmn1r58	C	A	7: 5,410,655	W192L	probably damaging	Het
Washc5	C	A	15: 59,339,862	C969F	probably damaging	Het
Zdhhc14	A	G	17: 5,726,856	K296R	probably benign	Het
Zfp281	T	A	1: 136,626,121	I279N	probably damaging	Het
Zfp9	G	T	6: 118,464,769	P311T	probably damaging	Het

Other mutations in Mkl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Mkl2	APN	16	13403222	missense	probably benign	0.28
IGL00546:Mkl2	APN	16	13403225	missense	possibly damaging	0.71
IGL01325:Mkl2	APN	16	13401224	missense	probably damaging	1.00
IGL02125:Mkl2	APN	16	13400183	splice site	probably null
IGL02803:Mkl2	APN	16	13403156	missense	possibly damaging	0.94
IGL03143:Mkl2	APN	16	13400812	missense	possibly damaging	0.46
IGL03180:Mkl2	APN	16	13398332	missense	probably damaging	1.00
R0281:Mkl2	UTSW	16	13412163	missense	probably damaging	0.99
R0505:Mkl2	UTSW	16	13412526	missense	possibly damaging	0.80
R0540:Mkl2	UTSW	16	13381601	missense	probably damaging	1.00
R0607:Mkl2	UTSW	16	13381601	missense	probably damaging	1.00
R1073:Mkl2	UTSW	16	13412318	missense	possibly damaging	0.89
R1423:Mkl2	UTSW	16	13412241	missense	possibly damaging	0.96
R1432:Mkl2	UTSW	16	13401002	missense	probably benign	0.01
R1459:Mkl2	UTSW	16	13401569	missense	possibly damaging	0.93
R1693:Mkl2	UTSW	16	13398470	missense	possibly damaging	0.67
R1693:Mkl2	UTSW	16	13398471	missense	probably damaging	0.99
R2006:Mkl2	UTSW	16	13381576	nonsense	probably null
R2076:Mkl2	UTSW	16	13401382	missense	probably benign	0.01
R2125:Mkl2	UTSW	16	13400804	missense	possibly damaging	0.94
R2145:Mkl2	UTSW	16	13412586	missense	probably damaging	0.98
R3722:Mkl2	UTSW	16	13385693	missense	probably damaging	1.00
R3883:Mkl2	UTSW	16	13401458	missense	probably damaging	0.99
R4204:Mkl2	UTSW	16	13403255	missense	possibly damaging	0.88
R4301:Mkl2	UTSW	16	13398305	missense	probably damaging	1.00
R4622:Mkl2	UTSW	16	13332706	missense	probably damaging	1.00
R4633:Mkl2	UTSW	16	13379873	missense	possibly damaging	0.95
R4765:Mkl2	UTSW	16	13412594	missense	probably damaging	1.00
R5201:Mkl2	UTSW	16	13401592	missense	probably benign	0.00
R5403:Mkl2	UTSW	16	13401013	missense	probably damaging	0.97
R5725:Mkl2	UTSW	16	13384310	nonsense	probably null
R6511:Mkl2	UTSW	16	13379850	missense	probably damaging	1.00
R7207:Mkl2	UTSW	16	13326436	missense	probably benign
R7269:Mkl2	UTSW	16	13401034	missense	possibly damaging	0.48
R7311:Mkl2	UTSW	16	13405854	nonsense	probably null
R7460:Mkl2	UTSW	16	13400976	missense	probably benign	0.00
Z1177:Mkl2	UTSW	16	13385606	missense	not run

Predicted Primers

PCR Primer
(F):5'- GCAGTTCCCATTGCAGCTTC -3'
(R):5'- TGACGTTAGCATCTTAGTCAGATC -3'

Sequencing Primer
(F):5'- CATTGCAGCTTCAGTTCATGG -3'
(R):5'- TTTCTCCCAGAAGACTGAGGCTAG -3'

Posted On

2015-05-15