Incidental Mutation 'R4089:Brca1'
ID317521
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 040982-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4089 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101524176 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1044 (N1044S)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017290
AA Change: N1044S

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: N1044S

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188168
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Meta Mutation Damage Score 0.0897 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Actr5 T C 2: 158,625,102 probably benign Het
Arhgef17 T A 7: 100,883,799 E1173V probably damaging Het
Cap1 A G 4: 122,862,409 V398A probably benign Het
Cbs A C 17: 31,633,006 C8G probably benign Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dip2a T C 10: 76,278,489 probably null Het
Dock9 A T 14: 121,583,471 C1494S probably damaging Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fbn2 C T 18: 58,053,769 D1687N probably benign Het
Flt1 C A 5: 147,564,241 L1327F probably benign Het
Frem3 T C 8: 80,615,173 F1365S probably damaging Het
Gigyf2 A G 1: 87,443,672 E1169G probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm14443 T C 2: 175,171,892 Y29C probably damaging Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Ifngr1 T C 10: 19,601,485 probably null Het
Il31ra C T 13: 112,551,919 W41* probably null Het
Ints4 T A 7: 97,529,255 Y687* probably null Het
Jpt2 A G 17: 24,956,102 S37P probably benign Het
Kcnk9 A G 15: 72,546,263 V6A probably benign Het
Lamc3 C T 2: 31,920,508 R797* probably null Het
Lrig1 A G 6: 94,609,859 I612T possibly damaging Het
Mapk4 C A 18: 73,930,459 C564F probably damaging Het
Marveld2 T A 13: 100,600,480 H215L probably benign Het
Mindy3 T C 2: 12,364,516 M84V probably benign Het
Nek3 T C 8: 22,149,913 D182G probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Pkp3 G A 7: 141,084,143 R411H probably damaging Het
Plau A G 14: 20,841,066 D366G probably damaging Het
Prkd3 A G 17: 78,971,388 M423T possibly damaging Het
Prmt9 A T 8: 77,572,545 I623L probably benign Het
Rgs6 A T 12: 83,063,487 E175D probably damaging Het
Rnf135 G A 11: 80,199,046 G403S probably damaging Het
Scn11a C T 9: 119,795,653 probably null Het
Snap23 C T 2: 120,584,375 probably benign Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sox10 C T 15: 79,156,363 V165M possibly damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Tex14 A G 11: 87,512,203 D533G probably damaging Het
Topbp1 T C 9: 103,324,501 probably null Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Trip4 A G 9: 65,858,283 V378A probably benign Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Washc2 A T 6: 116,256,292 probably null Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGGTCATCAGGTGTCTCAG -3'
(R):5'- GGGACGATTTGAGAGACATACATC -3'

Sequencing Primer
(F):5'- TCAGGTGTCTCAGAGCAAACCTG -3'
(R):5'- TACATCATCAACTGAGATGGCG -3'
Posted On2015-05-15